| Title: | Fast and Portable Character String Processing Facilities |
|---|---|
| Description: | A collection of character string/text/natural language processing tools for pattern searching (e.g., with 'Java'-like regular expressions or the 'Unicode' collation algorithm), random string generation, case mapping, string transliteration, concatenation, sorting, padding, wrapping, Unicode normalisation, date-time formatting and parsing, and many more. They are fast, consistent, convenient, and - thanks to 'ICU' (International Components for Unicode) - portable across all locales and platforms. Documentation about 'stringi' is provided via its website at <https://stringi.gagolewski.com/> and the paper by Gagolewski (2022, <doi:10.18637/jss.v103.i02>). |
| Authors: | Marek Gagolewski [aut, cre, cph] (ORCID: <https://orcid.org/0000-0003-0637-6028>), Bartek Tartanus [ctb], Unicode, Inc. and others [ctb] (ICU4C source code, Unicode Character Database) |
| Maintainer: | Marek Gagolewski <[email protected]> |
| License: | file LICENSE |
| Version: | 1.8.7 |
| Built: | 2026-06-01 09:00:55 UTC |
| Source: | https://github.com/gagolews/stringi |
stringi is THE R package for fast, correct, consistent, and convenient string/text manipulation. It gives predictable results on every platform, in each locale, and under any native character encoding.
Keywords: R, text processing, character strings, internationalization, localization, ICU, ICU4C, i18n, l10n, Unicode.
Homepage: https://stringi.gagolewski.com/
License: The BSD-3-clause license for the package code, the ICU license for the accompanying ICU4C distribution, and the UCD license for the Unicode Character Database. See the COPYRIGHTS and LICENSE file for more details.
Manual pages on general topics:
about_encoding – character encoding issues, including information on encoding management in stringi, as well as on encoding detection and conversion.
about_locale – locale issues, including locale
management and specification in stringi, and the list of
locale-sensitive operations. In particular, see
stri_opts_collator for a description of the string
collation algorithm, which is used for string comparing, ordering,
ranking, sorting, case-folding, and searching.
about_arguments – information on how stringi handles the arguments passed to its function.
Refer to the following:
about_search for string searching facilities; these include pattern searching, matching, string splitting, and so on. The following independent search engines are provided:
about_search_regex – with ICU (Java-like) regular expressions,
about_search_fixed – fast, locale-independent, byte-wise pattern matching,
about_search_coll – locale-aware pattern matching for natural language processing tasks,
about_search_charclass – seeking elements of particular character classes, like “all whites-paces” or “all digits”,
about_search_boundaries – text boundary analysis.
stri_datetime_format for date/time formatting
and parsing. Also refer to the links therein for other date/time/time zone-
related operations.
stri_stats_general and stri_stats_latex
for gathering some fancy statistics on a character vector's contents.
stri_join, stri_dup, %s+%,
and stri_flatten for concatenation-based operations.
stri_sub for extracting and replacing substrings,
and stri_reverse for a joyful function
to reverse all code points in a string.
stri_length (among others) for determining the number
of code points in a string. See also stri_count_boundaries
for counting the number of Unicode characters
and stri_width for approximating the width of a string.
stri_trim (among others) for
trimming characters from the beginning or/and end of a string,
see also about_search_charclass, and stri_pad
for padding strings so that they are of the same width.
Additionally, stri_wrap wraps text into lines.
stri_trans_tolower (among others) for case mapping,
i.e., conversion to lower, UPPER, or Title Case,
stri_trans_nfc (among others) for Unicode normalization,
stri_trans_char for translating individual code points,
and stri_trans_general for other universal
text transforms, including transliteration.
stri_cmp, %s<%, stri_order,
stri_sort, stri_rank, stri_unique,
and stri_duplicated for collation-based,
locale-aware operations, see also about_locale.
stri_split_lines (among others)
to split a string into text lines.
stri_escape_unicode (among others) for escaping
some code points.
stri_rand_strings, stri_rand_shuffle,
and stri_rand_lipsum for generating (pseudo)random strings.
stri_read_raw,
stri_read_lines, and stri_write_lines
for reading and writing text files.
Note that each man page provides many further links to other interesting facilities and topics.
Marek Gagolewski, with contributions from Bartek Tartanus and many others. ICU4C was developed by IBM, Unicode, Inc., and others.
stringi Package Homepage, https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
ICU – International Components for Unicode, https://icu.unicode.org/
ICU4C API Documentation, https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/
The Unicode Consortium, https://home.unicode.org/
UTF-8, A Transformation Format of ISO 10646 – RFC 3629, https://www.rfc-editor.org/rfc/rfc3629
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Useful links:
Report bugs at https://github.com/gagolews/stringi/issues
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex
Binary operators for joining (concatenating) two character vectors, with a typical R look-and-feel.
e1 %s+% e2 e1 %stri+% e2e1 %s+% e2 e1 %stri+% e2
e1 |
a character vector or an object coercible to a character vector |
e2 |
a character vector or an object coercible to a character vector |
Vectorized over e1 and e2.
These operators act like a call to stri_join(e1, e2, sep='').
However, note that joining 3 vectors, e.g., e1 %s+% e2 %s+% e3
is slower than stri_join(e1, e2, e3, sep=''),
because it creates a new (temporary) result vector each time
the operator is applied.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other join:
stri_dup(),
stri_flatten(),
stri_join(),
stri_join_list()
c('abc', '123', 'xy') %s+% letters[1:6] 'ID_' %s+% 1:5c('abc', '123', 'xy') %s+% letters[1:6] 'ID_' %s+% 1:5
Relational operators for comparing corresponding strings in two character vectors, with a typical R look-and-feel.
e1 %s<% e2 e1 %s<=% e2 e1 %s>% e2 e1 %s>=% e2 e1 %s==% e2 e1 %s!=% e2 e1 %s===% e2 e1 %s!==% e2 e1 %stri<% e2 e1 %stri<=% e2 e1 %stri>% e2 e1 %stri>=% e2 e1 %stri==% e2 e1 %stri!=% e2 e1 %stri===% e2 e1 %stri!==% e2e1 %s<% e2 e1 %s<=% e2 e1 %s>% e2 e1 %s>=% e2 e1 %s==% e2 e1 %s!=% e2 e1 %s===% e2 e1 %s!==% e2 e1 %stri<% e2 e1 %stri<=% e2 e1 %stri>% e2 e1 %stri>=% e2 e1 %stri==% e2 e1 %stri!=% e2 e1 %stri===% e2 e1 %stri!==% e2
e1, e2
|
character vectors or objects coercible to character vectors |
These functions call stri_cmp_le or its
friends, using the default collator options.
As a consequence, they are vectorized over e1 and e2.
%stri==% tests for canonical equivalence of strings
(see stri_cmp_equiv) and is a locale-dependent operation.
%stri===% performs a locale-independent,
code point-based comparison.
All the functions return a logical vector indicating the result of a pairwise comparison. As usual, the elements of shorter vectors are recycled if necessary.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
'a' %stri<% 'b' c('a', 'b', 'c') %stri>=% 'b''a' %stri<% 'b' c('a', 'b', 'c') %stri>=% 'b'
stri_sprintf as a Binary OperatorProvides access to stri_sprintf in form of a binary
operator in a way similar to Python's % overloaded for strings.
Missing values and empty vectors are propagated as usual.
e1 %s$% e2 e1 %stri$% e2e1 %s$% e2 e1 %stri$% e2
e1 |
format strings, see |
e2 |
a list of atomic vectors to be passed to |
Vectorized over e1 and e2.
e1 %s$% atomic_vector is equivalent to
e1 %s$% list(atomic_vector).
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
stri_isempty(),
stri_length(),
stri_numbytes(),
stri_pad_both(),
stri_sprintf(),
stri_width()
"value='%d'" %s$% 3 "value='%d'" %s$% 1:3 "%s='%d'" %s$% list("value", 3) "%s='%d'" %s$% list("value", 1:3) "%s='%d'" %s$% list(c("a", "b", "c"), 1) "%s='%d'" %s$% list(c("a", "b", "c"), 1:3) x <- c("abcd", "\u00DF\u00B5\U0001F970", "abcdef") cat("[%6s]" %s$% x, sep="\n") # width used, not the number of bytes"value='%d'" %s$% 3 "value='%d'" %s$% 1:3 "%s='%d'" %s$% list("value", 3) "%s='%d'" %s$% list("value", 1:3) "%s='%d'" %s$% list(c("a", "b", "c"), 1) "%s='%d'" %s$% list(c("a", "b", "c"), 1:3) x <- c("abcd", "\u00DF\u00B5\U0001F970", "abcdef") cat("[%6s]" %s$% x, sep="\n") # width used, not the number of bytes
Below we explain how stringi deals with its functions' arguments.
If some function violates one of the following rules (for a very important reason), this is clearly indicated in its documentation (with discussion).
When a character vector argument is expected, factors and other vectors
coercible to characters vectors are silently converted with
as.character, otherwise an error is generated.
Coercion from a list which does not consist of length-1 atomic vectors
issues a warning.
When a logical, numeric, or integer vector argument is expected,
factors are converted with as.*(as.character(...)),
and other coercible vectors are converted with as.*,
otherwise an error is generated.
Almost all functions are vectorized with respect to all their arguments and the recycling rule is applied whenever necessary. Due to this property you may, for instance, search for one pattern in each given string, search for each pattern in one given string, and search for the i-th pattern within the i-th string.
We of course took great care of performance issues: e.g., in regular expression searching, regex matchers are reused from iteration to iteration, as long as it is possible.
Functions with some non-vectorized arguments are rare: e.g., regular expression matcher's settings are established once per each call.
Some functions
assume that a vector with one element is given
as an argument (like collapse in stri_join).
In such cases, if an empty vector is given you will get an error
and for vectors with more than 1 elements - a warning will be
generated (only the first element will be used).
You may find details on vectorization behavior in the man pages on each particular function of your interest.
NAs)stringi handles missing values consistently.
For any vectorized operation, if at least one vector element is missing,
then the corresponding resulting value is also set to NA.
Generally, all our functions drop input objects' attributes
(e.g., names, dim, etc.).
This is due to deep vectorization as well as for efficiency reasons.
If the preservation of attributes is needed,
important attributes can be manually copied. Alternatively, the notation
x[] <- stri_...(x, ...) can sometimes be used too.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other stringi_general_topics:
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
This manual page explains how stringi deals with character strings in various encodings.
In particular we should note that:
R lets strings in ASCII, UTF-8, and your platform's
native encoding coexist. A character vector printed on the console
by calling print or cat is
silently re-encoded to the native encoding.
Functions in stringi process each string internally in Unicode, the most universal character encoding ever. Even if a string is given in the native encoding, i.e., your platform's default one, it will be converted to Unicode (precisely: UTF-8 or UTF-16).
Most stringi functions always return UTF-8 encoded strings, regardless of the input encoding. What is more, the functions have been optimized for UTF-8/ASCII input (they have competitive, if not better performance, especially when performing more complex operations like string comparison, sorting, and even concatenation). Thus, it is best to rely on cascading calls to stringi operations solely.
Quoting the ICU User Guide, 'Hundreds of encodings have been developed over the years, each for small groups of languages and for special purposes. As a result, the interpretation of text, input, sorting, display, and storage depends on the knowledge of all the different types of character sets and their encodings. Programs have been written to handle either one single encoding at a time and switch between them, or to convert between external and internal encodings.'
'Unicode provides a single character set that covers the major languages of the world, and a small number of machine-friendly encoding forms and schemes to fit the needs of existing applications and protocols. It is designed for best interoperability with both ASCII and ISO-8859-1 (the most widely used character sets) to make it easier for Unicode to be used in almost all applications and protocols' (see the ICU User Guide).
The Unicode Standard determines the way to map any possible character to a numeric value – a so-called code point. Such code points, however, have to be stored somehow in computer's memory. The Unicode Standard encodes characters in the range U+0000..U+10FFFF, which amounts to a 21-bit code space. Depending on the encoding form (UTF-8, UTF-16, or UTF-32), each character will then be represented either as a sequence of one to four 8-bit bytes, one or two 16-bit code units, or a single 32-bit integer (compare the ICU FAQ).
Unicode can be thought of as a superset of the spectrum of characters supported by any given code page.
For portability reasons, the UTF-8 encoding is the most natural choice
for representing Unicode character strings in R. UTF-8 has ASCII as its
subset (code points 1–127 represent the same characters in both of them).
Code points larger than 127 are represented by multi-byte sequences
(from 2 to 4 bytes: Please note that not all sequences of bytes
are valid UTF-8, compare stri_enc_isutf8).
Most of the computations in stringi are performed internally using either UTF-8 or UTF-16 encodings (this depends on type of service you request: some ICU services are designed only to work with UTF-16). Due to such a choice, with stringi you get the same result on each platform, which is – unfortunately – not the case of base R's functions (for instance, it is known that performing a regular expression search under Linux on some texts may give you a different result to those obtained under Windows). We really had portability in our minds while developing our package!
We have observed that R correctly handles UTF-8 strings regardless of your platform's native encoding (see below). Therefore, we decided that most functions in stringi will output its results in UTF-8 – this speeds ups computations on cascading calls to our functions: the strings does not have to be re-encoded each time.
Note that some Unicode characters may have an ambiguous representation.
For example, “a with ogonek” (one character) and “a”+“ogonek”
(two graphemes) are semantically the same. stringi provides functions
to normalize character sequences, see stri_trans_nfc
for discussion. However, it is observed that denormalized strings
do appear very rarely in typical string processing activities.
Additionally, do note that stringi silently removes byte order marks
(BOMs - they may incidentally appear in a string read from a text file)
from UTF8-encoded strings, see stri_enc_toutf8.
Data in memory are just bytes (small integer values) – an encoding is a way to represent characters with such numbers, it is a semantic 'key' to understand a given byte sequence. For example, in ISO-8859-2 (Central European), the value 177 represents Polish “a with ogonek”, and in ISO-8859-1 (Western European), the same value denotes the “plus-minus” sign. Thus, a character encoding is a translation scheme: we need to communicate with R somehow, relying on how it represents strings.
Overall, R has a very simple encoding marking mechanism,
see stri_enc_mark. There is an implicit assumption
that your platform's default (native) encoding always extends
ASCII – stringi checks that whenever your native encoding
is being detected automatically on ICU's initialization and each time
when you change it manually by calling stri_enc_set.
Character strings in R (internally) can be declared to be in:
UTF-8;
latin1, i.e., either ISO-8859-1 (Western European on
Linux, OS X, and other Unixes) or WINDOWS-1252 (Windows);
bytes – for strings that
should be manipulated as sequences of bytes.
Moreover, there are two other cases:
ASCII – for strings consisting only of byte codes not greater than 127;
native (a.k.a. unknown in Encoding;
quite a misleading name: no explicit encoding mark) – for
strings that are assumed to be in your platform's native (default) encoding.
This can represent UTF-8 if you are an OS X user,
or some 8-bit Windows code page, for example.
The native encoding used by R may be determined by examining
the LC_CTYPE category, see Sys.getlocale.
Intuitively, “native” strings result from reading a string from stdin (e.g., keyboard input). This makes sense: your operating system works in some encoding and provides R with some data.
Each time when a stringi function encounters a string declared
in native encoding, it assumes that the input data should be translated
from the default encoding, i.e., the one returned by stri_enc_get
(unless you know what you are doing, the default encoding should only be
changed if the automatic encoding detection process fails on stringi
load).
Functions which allow 'bytes' encoding markings are very rare in
stringi, and were carefully selected. These are:
stri_enc_toutf8 (with argument is_unknown_8bit=TRUE),
stri_enc_toascii, and stri_encode.
Finally, note that R lets strings in ASCII, UTF-8, and your platform's
native encoding coexist. A character vector printed with
print, cat, etc., is silently re-encoded
so that it can be properly shown, e.g., on the console.
Apart from automatic conversion from the native encoding,
you may re-encode a string manually, for example
when you read it from a file created on a different platform.
Call stri_enc_list for the list of
encodings supported by ICU.
Note that converter names are case-insensitive
and ICU tries to normalize the encoding specifiers.
Leading zeroes are ignored in sequences of digits (if further digits follow),
and all non-alphanumeric characters are ignored. Thus the strings
'UTF-8', 'utf_8', 'u*Tf08' and 'Utf 8' are equivalent.
The stri_encode function
allows you to convert between any given encodings
(in some cases you will obtain bytes-marked
strings, or even lists of raw vectors (i.e., for UTF-16).
There are also some useful more specialized functions,
like stri_enc_toutf32 (converts a character vector to a list
of integers, where one code point is exactly one numeric value)
or stri_enc_toascii (substitutes all non-ASCII
bytes with the SUBSTITUTE CHARACTER,
which plays a similar role as R's NA value).
There are also some routines for automated encoding detection,
see, e.g., stri_enc_detect.
Given a text file, one has to know how to interpret (encode) raw data in order to obtain meaningful information.
Encoding detection is always an imprecise operation and needs a considerable amount of data. However, in case of some encodings (like UTF-8, ASCII, or UTF-32) a “false positive” byte sequence is quite rare (statistically speaking).
Check out stri_enc_detect (among others) for a useful
function in this category.
Marek Gagolewski and other contributors
Unicode Basics – ICU User Guide, https://unicode-org.github.io/icu/userguide/icu/unicode.html
Conversion – ICU User Guide, https://unicode-org.github.io/icu/userguide/conversion/
Converters – ICU User Guide, https://unicode-org.github.io/icu/userguide/conversion/converters.html (technical details)
UTF-8, UTF-16, UTF-32 & BOM – ICU FAQ, https://www.unicode.org/faq/utf_bom.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other stringi_general_topics:
about_arguments,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
Other encoding_management:
stri_enc_info(),
stri_enc_list(),
stri_enc_mark(),
stri_enc_set()
Other encoding_detection:
stri_enc_detect(),
stri_enc_detect2(),
stri_enc_isascii(),
stri_enc_isutf16be(),
stri_enc_isutf8()
Other encoding_conversion:
stri_enc_fromutf32(),
stri_enc_toascii(),
stri_enc_tonative(),
stri_enc_toutf32(),
stri_enc_toutf8(),
stri_encode()
In this section we explain how we specify locales in stringi. Locale is a fundamental concept in ICU. It identifies a specific user community, i.e., a group of users who have similar culture and language expectations for human-computer interaction.
Because a locale is just an identifier of a region, no validity check is performed when you specify a Locale. ICU is implemented as a set of services. If you want to verify whether particular resources are available in the locale you asked for, you must query those resources. Note: when you ask for a resource for a particular locale, you get back the best available match, not necessarily precisely the one you requested.
ICU services are parametrized by locale,
to deliver culturally correct results.
Locales are identified by character strings
of the form Language code,
Language_Country code, or Language_Country_Variant
code, e.g., 'en_US'.
The two-letter Language code uses the ISO-639-1 standard,
e.g., 'en' stands for English, 'pl' – Polish, 'fr' – French,
and 'de' for German.
Country is a two-letter code following the ISO-3166 standard.
This is to reflect different language conventions within the same language,
for example in US-English ('en_US') and Australian-English ('en_AU').
Differences may also appear in language conventions used within
the same country. For example, the Euro currency may be used in several European
countries while the individual country's currency is still in circulation.
In such a case, ICU Variant '_EURO' could be used for selecting
locales that support the Euro currency.
The final (optional) element of a locale is a list of
keywords together with their values. Keywords must be unique.
Their order is not significant. Unknown keywords are ignored.
The handling of keywords depends on the specific services that
utilize them. Currently, the following keywords are recognized:
calendar, collation, currency, and numbers,
e.g., fr@collation=phonebook;calendar=islamic-civil is a valid
French locale specifier together with keyword arguments. For
more information, refer to the ICU user guide.
For a list of locales that are recognized by ICU,
call stri_locale_list.
Note that in stringi, 'C' is a synonym of 'en_US_POSIX'.
Each locale-sensitive function in stringi
selects the current default locale if an empty string or NULL
is provided as its locale argument. Default locales are available
to all the functions; initially, the system locale on that platform is used,
but it may be changed by calling stri_locale_set.
Your program should avoid changing the default locale.
All locale-sensitive functions may request
any desired locale per-call (by specifying the locale argument),
i.e., without referencing to the default locale.
During many tests, however, we did not observe any improper
behavior of stringi while using a modified default locale.
One of many examples of locale-dependent services is the Collator, which
performs a locale-aware string comparison. It is used for string comparing,
ordering, sorting, and searching. See stri_opts_collator
for the description on how to tune its settings, and its locale
argument in particular.
When choosing a resource bundle that is not available in the explicitly requested locale (but not when using the default locale) nor in its more general variants (e.g., 'es_ES' vs 'es'), a warning is emitted.
Other locale-sensitive functions include, e.g.,
stri_trans_tolower (that does character case mapping).
Marek Gagolewski and other contributors
Locale – ICU User Guide, https://unicode-org.github.io/icu/userguide/locale/
ISO 639: Language Codes, https://www.iso.org/iso-639-language-codes.html
ISO 3166: Country Codes, https://www.iso.org/iso-3166-country-codes.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_management:
stri_locale_info(),
stri_locale_list(),
stri_locale_set()
Other locale_sensitive:
%s<%(),
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
This man page explains how to perform string search-based operations in stringi.
The following independent string searching engines are available in stringi.
stri_*_regex – ICU's regular expressions (regexes),
see about_search_regex,
stri_*_fixed – locale-independent byte-wise pattern matching,
see about_search_fixed,
stri_*_coll – ICU's StringSearch,
locale-sensitive, Collator-based pattern search,
useful for natural language processing tasks,
see about_search_coll,
stri_*_charclass – character classes search,
e.g., Unicode General Categories or Binary Properties,
see about_search_charclass,
stri_*_boundaries – text boundary analysis,
see about_search_boundaries
Each search engine is able to perform many search-based operations. These may include:
stri_detect_* - detect if a pattern occurs in a string,
see, e.g., stri_detect,
stri_count_* - count the number of pattern occurrences,
see, e.g., stri_count,
stri_locate_* - locate all, first, or last occurrences
of a pattern, see, e.g., stri_locate,
stri_extract_* - extract all, first, or last occurrences
of a pattern, see, e.g., stri_extract
and, in case of regexes, stri_match,
stri_replace_* - replace all, first, or last occurrences
of a pattern, see, e.g., stri_replace
and also stri_trim,
stri_split_* - split a string into chunks indicated
by occurrences of a pattern,
see, e.g., stri_split,
stri_startswith_* and stri_endswith_* detect
if a string starts or ends with a pattern match, see,
e.g., stri_startswith,
stri_subset_* - return a subset of a character vector
with strings that match a given pattern, see, e.g., stri_subset.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other text_boundaries:
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
Other search_regex:
about_search_regex,
stri_opts_regex()
Other search_fixed:
about_search_fixed,
stri_opts_fixed()
Other search_coll:
about_search_coll,
stri_opts_collator()
Other search_charclass:
about_search_charclass,
stri_trim_both()
Other search_detect:
stri_detect(),
stri_startswith()
Other search_count:
stri_count(),
stri_count_boundaries()
Other search_locate:
stri_locate_all(),
stri_locate_all_boundaries()
Other search_replace:
stri_replace_all(),
stri_replace_rstr(),
stri_trim_both()
Other search_split:
stri_split(),
stri_split_boundaries(),
stri_split_lines()
Other search_subset:
stri_subset()
Other search_extract:
stri_extract_all(),
stri_extract_all_boundaries(),
stri_match_all()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
Text boundary analysis is the process of locating linguistic boundaries while formatting and handling text.
Examples of the boundary analysis process include:
Locating positions to word-wrap text to fit
within specific margins while displaying or printing,
see stri_wrap and stri_split_boundaries.
Counting characters, words, sentences, or paragraphs,
see stri_count_boundaries.
Making a list of the unique words in a document,
see stri_extract_all_words and then stri_unique.
Capitalizing the first letter of each word
or sentence, see also stri_trans_totitle.
Locating a particular unit of the text (for example,
finding the third word in the document),
see stri_locate_all_boundaries.
Generally, text boundary analysis is a locale-dependent operation. For example, in Japanese and Chinese one does not separate words with spaces - a line break can occur even in the middle of a word. These languages have punctuation and diacritical marks that cannot start or end a line, so this must also be taken into account.
stringi uses ICU's BreakIterator to locate specific
text boundaries. Note that the BreakIterator's behavior
may be controlled in come cases, see stri_opts_brkiter.
The character boundary iterator tries to match what a user
would think of as a “character” – a basic unit of a writing system
for a language – which may be more than just a single Unicode code point.
The word boundary iterator locates the boundaries
of words, for purposes such as “Find whole words” operations.
The line_break iterator locates positions that would
be appropriate to wrap lines when displaying the text.
The break iterator of type sentence
locates sentence boundaries.
For technical details on different classes of text boundaries refer to the ICU User Guide, see below.
Marek Gagolewski and other contributors
Boundary Analysis – ICU User Guide, https://unicode-org.github.io/icu/userguide/boundaryanalysis/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other text_boundaries:
about_search,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_charclass,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
Here we describe how character classes (sets) can be specified
in the stringi package. These are useful for defining
search patterns (note that the ICU regex engine uses the same
scheme for denoting character classes) or, e.g.,
generating random code points with stri_rand_strings.
All stri_*_charclass functions in stringi perform
a single character (i.e., Unicode code point) search-based operations.
You may obtain the same results using about_search_regex.
However, these very functions aim to be faster.
Character classes are defined using ICU's UnicodeSet
patterns. Below we briefly summarize their syntax.
For more details refer to the bibliographic References below.
UnicodeSet patternsA UnicodeSet represents a subset of Unicode code points
(recall that stringi converts strings in your native encoding
to Unicode automatically). Legal code points are U+0000 to U+10FFFF,
inclusive.
Patterns either consist of series of characters bounded by square brackets (such patterns follow a syntax similar to that employed by regular expression character classes) or of Perl-like Unicode property set specifiers.
[] denotes an empty set, [a] –
a set consisting of character “a”,
[\u0105] – a set with character U+0105,
and [abc] – a set with “a”, “b”, and “c”.
[a-z] denotes a set consisting of characters
“a” through “z” inclusively, in Unicode code point order.
Some set-theoretic operations are available.
^ denotes the complement, e.g., [^a-z] contains
all characters but “a” through “z”.
Moreover, [[pat1][pat2]],
[[pat1]\&[pat2]], and [[pat1]-[pat2]]
denote union, intersection, and asymmetric difference of sets
specified by pat1 and pat2, respectively.
Note that all white-spaces are ignored unless they are quoted or back-slashed
(white spaces can be freely used for clarity, as [a c d-f m]
means the same as [acd-fm]).
stringi does not allow including multi-character strings
(see UnicodeSet API documentation).
Also, empty string patterns are disallowed.
Any character may be preceded by a backslash in order to remove its special meaning.
A malformed pattern always results in an error.
Set expressions at a glance (according to https://unicode-org.github.io/icu/userguide/strings/regexp.html):
Some examples:
[abc]Match any of the characters a, b or c.
[^abc]Negation – match any character except a, b or c.
[A-M]Range – match any character from A to M. The characters to include are determined by Unicode code point ordering.
[\u0000-\U0010ffff]Range – match all characters.
[\p{Letter}] or [\p{General_Category=Letter}] or [\p{L}]
Characters with Unicode Category = Letter. All forms shown are equivalent.
[\P{Letter}]Negated property
(Note the upper case \P) – match everything except Letters.
[\p{numeric_value=9}]Match all numbers with a numeric value of 9. Any Unicode Property may be used in set expressions.
[\p{Letter}&\p{script=cyrillic}]Set intersection – match the set of all Cyrillic letters.
[\p{Letter}-\p{script=latin}]Set difference – match all non-Latin letters.
[[a-z][A-Z][0-9]] or [a-zA-Z0-9]
Implicit union of sets – match ASCII letters and digits (the two forms are equivalent).
[:script=Greek:]Alternative POSIX-like syntax for properties –
equivalent to \p{script=Greek}.
Unicode property sets are specified with a POSIX-like syntax,
e.g., [:Letter:],
or with a (extended) Perl-style syntax, e.g., \p{L}.
The complements of the above sets are
[:^Letter:] and \P{L}, respectively.
The names are normalized before matching (for example, the match is case-insensitive). Moreover, many names have short aliases.
Among predefined Unicode properties we find, e.g.:
Unicode General Categories, e.g., Lu for uppercase letters,
Unicode Binary Properties, e.g., WHITE_SPACE,
and many more (including Unicode scripts).
Each property provides access to the large and comprehensive Unicode Character Database. Generally, the list of properties available in ICU is not well-documented. Please refer to the References section for some links.
Please note that some classes might overlap.
However, e.g., General Category Z (some space) and Binary Property
WHITE_SPACE matches different character sets.
The Unicode General Category property of a code point provides the most general classification of that code point. Each code point falls into one and only one Category.
Cca C0 or C1 control code.
Cfa format control character.
Cna reserved unassigned code point or a non-character.
Coa private-use character.
Csa surrogate code point.
Lcthe union of Lu, Ll, Lt.
Lla lowercase letter.
Lma modifier letter.
Loother letters, including syllables and ideographs.
Lta digraphic character, with the first part uppercase.
Luan uppercase letter.
Mca spacing combining mark (positive advance width).
Mean enclosing combining mark.
Mna non-spacing combining mark (zero advance width).
Nda decimal digit.
Nla letter-like numeric character.
Noa numeric character of other type.
Pda dash or hyphen punctuation mark.
Psan opening punctuation mark (of a pair).
Pea closing punctuation mark (of a pair).
Pca connecting punctuation mark, like a tie.
Poa punctuation mark of other type.
Pian initial quotation mark.
Pfa final quotation mark.
Sma symbol of mathematical use.
Sca currency sign.
Ska non-letter-like modifier symbol.
Soa symbol of other type.
Zsa space character (of non-zero width).
ZlU+2028 LINE SEPARATOR only.
ZpU+2029 PARAGRAPH SEPARATOR only.
C the union of Cc, Cf, Cs, Co, Cn.
L the union of Lu, Ll, Lt, Lm, Lo.
M the union of Mn, Mc, Me.
N the union of Nd, Nl, No.
P the union of Pc, Pd, Ps, Pe, Pi, Pf, Po.
S the union of Sm, Sc, Sk, So.
Z the union of Zs, Zl, Zp
Each character may follow many Binary Properties at a time.
Here is a comprehensive list of supported Binary Properties:
ALPHABETIC alphabetic character.
ASCII_HEX_DIGITa character matching the [0-9A-Fa-f] charclass.
BIDI_CONTROL a format control which have specific functions in the Bidi (bidirectional text) Algorithm.
BIDI_MIRRORED a character that may change display in right-to-left text.
DASH a kind of a dash character.
DEFAULT_IGNORABLE_CODE_POINTcharacters that are ignorable in most text processing activities, e.g., <2060..206F, FFF0..FFFB, E0000..E0FFF>.
DEPRECATED a deprecated character according to the current Unicode standard (the usage of deprecated characters is strongly discouraged).
DIACRITIC a character that linguistically modifies the meaning of another character to which it applies.
EXTENDER a character that extends the value or shape of a preceding alphabetic character, e.g., a length and iteration mark.
HEX_DIGIT a character commonly
used for hexadecimal numbers,
see also ASCII_HEX_DIGIT.
HYPHENa dash used to mark connections between pieces of words, plus the Katakana middle dot.
ID_CONTINUEa character that can continue an identifier,
ID_START+Mn+Mc+Nd+Pc.
ID_STARTa character that can start an identifier,
Lu+Ll+Lt+Lm+Lo+Nl.
IDEOGRAPHICa CJKV (Chinese-Japanese-Korean-Vietnamese) ideograph.
LOWERCASE...
MATH...
NONCHARACTER_CODE_POINT...
QUOTATION_MARK...
SOFT_DOTTEDa character with a “soft dot”, like i or j, such that an accent placed on this character causes the dot to disappear.
TERMINAL_PUNCTUATIONa punctuation character that generally marks the end of textual units.
UPPERCASE...
WHITE_SPACEa space character or TAB or CR or LF or ZWSP or ZWNBSP.
CASE_SENSITIVE...
POSIX_ALNUM...
POSIX_BLANK...
POSIX_GRAPH...
POSIX_PRINT...
POSIX_XDIGIT...
CASED...
CASE_IGNORABLE...
CHANGES_WHEN_LOWERCASED...
CHANGES_WHEN_UPPERCASED...
CHANGES_WHEN_TITLECASED...
CHANGES_WHEN_CASEFOLDED...
CHANGES_WHEN_CASEMAPPED...
CHANGES_WHEN_NFKC_CASEFOLDED...
EMOJISince ICU 57
EMOJI_PRESENTATIONSince ICU 57
EMOJI_MODIFIERSince ICU 57
EMOJI_MODIFIER_BASESince ICU 57
Avoid using POSIX character classes,
e.g., [:punct:]. The ICU User Guide (see below)
states that in general they are not well-defined, so you may end up
with something different than you expect.
In particular, in POSIX-like regex engines, [:punct:] stands for
the character class corresponding to the ispunct() classification
function (check out man 3 ispunct on UNIX-like systems).
According to ISO/IEC 9899:1990 (ISO C90), the ispunct() function
tests for any printing character except for space or a character
for which isalnum() is true. However, in a POSIX setting,
the details of what characters belong into which class depend
on the current locale. So the [:punct:] class does not lead
to a portable code (again, in POSIX-like regex engines).
Therefore, a POSIX flavor of [:punct:] is more like
[\p{P}\p{S}] in ICU. You have been warned.
Marek Gagolewski and other contributors
The Unicode Character Database – Unicode Standard Annex #44, https://www.unicode.org/reports/tr44/
UnicodeSet – ICU User Guide, https://unicode-org.github.io/icu/userguide/strings/unicodeset.html
Properties – ICU User Guide, https://unicode-org.github.io/icu/userguide/strings/properties.html
C/POSIX Migration – ICU User Guide, https://unicode-org.github.io/icu/userguide/icu/posix.html
Unicode Script Data, https://www.unicode.org/Public/UNIDATA/Scripts.txt
icu::Unicodeset Class Reference – ICU4C API Documentation, https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/classicu_1_1UnicodeSet.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_charclass:
about_search,
stri_trim_both()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_coll,
about_search_fixed,
about_search_regex,
stringi-package
String searching facilities described here provide a way to locate a specific piece of text. Interestingly, locale-sensitive searching, especially on a non-English text, is a much more complex process than it seems at first glance.
All stri_*_coll functions in stringi use
ICU's StringSearch engine,
which implements a locale-sensitive string search algorithm.
The matches are defined by using the notion of “canonical equivalence”
between strings.
Tuning the Collator's parameters allows you to perform correct matching that properly takes into account accented letters, conjoined letters, ignorable punctuation and letter case.
For more information on ICU's Collator and the search engine
and how to tune it up
in stringi, refer to stri_opts_collator.
Please note that ICU's StringSearch-based functions
are often much slower that those to perform fixed pattern searches.
Marek Gagolewski and other contributors
ICU String Search Service – ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/string-search.html
L. Werner, Efficient Text Searching in Java, 1999, https://icu-project.org/docs/papers/efficient_text_searching_in_java.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_coll:
about_search,
stri_opts_collator()
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_fixed,
about_search_regex,
stringi-package
String searching facilities described here
provide a way to locate a specific sequence of bytes in a string.
The search engine's settings may be tuned up (for example
to perform case-insensitive search) via a call to the
stri_opts_fixed function.
The fast Knuth-Morris-Pratt search algorithm, with worst time complexity of
O(n+p) (n == length(str), p == length(pattern))
is implemented (with some tweaks for very short search patterns).
Be aware that, for natural language processing, fixed pattern searching might not be what you actually require. It is because a bitwise match will not give correct results in cases of:
accented letters;
conjoined letters;
ignorable punctuation;
ignorable case,
see also about_search_coll.
Note that the conversion of input data to Unicode is done as usual.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_fixed:
about_search,
stri_opts_fixed()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_regex,
stringi-package
A regular expression is a pattern describing, possibly in a very abstract way, a text fragment. With so many regex functions in stringi, regular expressions may be a very powerful tool to perform string searching, substring extraction, string splitting, etc., tasks.
All stri_*_regex functions in stringi use
the ICU regex engine. Its settings may be tuned up (for example
to perform case-insensitive search) via the
stri_opts_regex function.
Regular expression patterns in ICU are quite similar in form and
behavior to Perl's regexes. Their implementation is loosely inspired
by JDK 1.4 java.util.regex.
ICU Regular Expressions conform to the Unicode Technical Standard #18
(see References section) and its features are summarized in
the ICU User Guide (see below). A good general introduction
to regexes is (Friedl, 2002).
Some general topics are also covered in the R manual, see regex.
Here is a list of operators provided by the ICU User Guide on regexes.
|Alternation. A|B matches either A or B.
*Match 0 or more times. Match as many times as possible.
+Match 1 or more times. Match as many times as possible.
?Match zero or one times. Prefer one.
{n} Match exactly n times.
{n,} Match at least n times. Match as many times as possible.
{n,m} Match between n and m times. Match as many times as possible, but not more than m.
*?Match 0 or more times. Match as few times as possible.
+?Match 1 or more times. Match as few times as possible.
??Match zero or one times. Prefer zero.
{n}?Match exactly n times.
{n,}?Match at least n times, but no more than required for an overall pattern match.
{n,m}?Match between n and m times. Match as few times as possible, but not less than n.
*+Match 0 or more times. Match as many times as possible when first encountered, do not retry with fewer even if overall match fails (Possessive Match).
++Match 1 or more times. Possessive match.
?+Match zero or one times. Possessive match.
{n}+Match exactly n times.
{n,}+Match at least n times. Possessive Match.
{n,m}+Match between n and m times. Possessive Match.
(...)Capturing parentheses. Range of input that matched
the parenthesized sub-expression is available after the match,
see stri_match.
(?:...)Non-capturing parentheses. Groups the included pattern, but does not provide capturing of matching text. Somewhat more efficient than capturing parentheses.
(?>...)Atomic-match parentheses. The first match of the
parenthesized sub-expression is the only one tried; if it does not lead to
an overall pattern match, back up the search for a match to a position
before the (?>.
(?#...)Free-format comment (?# comment ).
(?=...)Look-ahead assertion. True if the parenthesized pattern matches at the current input position, but does not advance the input position.
(?!...)Negative look-ahead assertion. True if the parenthesized pattern does not match at the current input position. Does not advance the input position.
(?<=...)Look-behind assertion. True if the parenthesized
pattern matches text preceding the current input position, with the last
character of the match being the input character just before the current
position. Does not alter the input position. The length of possible strings
matched by the look-behind pattern must not be unbounded (no *
or + operators.)
(?<!...)Negative Look-behind assertion. True if the
parenthesized pattern does not match text preceding the current input
position, with the last character of the match being the input character
just before the current position. Does not alter the input position.
The length of possible strings matched by the look-behind pattern must
not be unbounded (no * or + operators.)
(?<name>...)Named capture group, where name
(enclosed within the angle brackets)
is a sequence like [A-Za-z][A-Za-z0-9]*
(?ismwx-ismwx:...)Flag settings. Evaluate the parenthesized
expression with the specified flags enabled or -disabled,
see also stri_opts_regex.
(?ismwx-ismwx)Flag settings. Change the flag settings.
Changes apply to the portion of the pattern following the setting.
For example, (?i) changes to a case insensitive match,
see also stri_opts_regex.
Here is a list of meta-characters provided by the ICU User Guide on regexes.
\aMatch a BELL, \u0007.
\AMatch at the beginning of the input. Differs from ^.
in that \A will not match after a new line within the input.
\bMatch if the current position is a word boundary.
Boundaries occur at the transitions between word (\w) and non-word
(\W) characters, with combining marks ignored. For better word
boundaries, see ICU Boundary Analysis, e.g., stri_extract_all_words.
\BMatch if the current position is not a word boundary.
\cXMatch a control-X character.
\dMatch any character with the Unicode General Category of
Nd (Number, Decimal Digit.).
\DMatch any character that is not a decimal digit.
\eMatch an ESCAPE, \u001B.
\ETerminates a \Q ... \E quoted sequence.
\fMatch a FORM FEED, \u000C.
\GMatch if the current position is at the end of the previous match.
\hMatch a Horizontal White Space character.
They are characters with Unicode General Category of Space_Separator plus
the ASCII tab, \u0009. [Since ICU 55]
\HMatch a non-Horizontal White Space character. [Since ICU 55]
\k<name>Named Capture Back Reference. [Since ICU 55]
\nMatch a LINE FEED, \u000A.
\N{UNICODE CHARACTER NAME} Match the named character.
\p{UNICODE PROPERTY NAME} Match any character with the specified Unicode Property.
\P{UNICODE PROPERTY NAME} Match any character not having the specified Unicode Property.
\QQuotes all following characters until \E.
\rMatch a CARRIAGE RETURN, \u000D.
\sMatch a white space character. White space is defined
as [\t\n\f\r\p{Z}].
\SMatch a non-white space character.
\tMatch a HORIZONTAL TABULATION, \u0009.
\uhhhhMatch the character with the hex value hhhh.
\UhhhhhhhhMatch the character with the hex value hhhhhhhh.
Exactly eight hex digits must be provided, even though the largest
Unicode code point is \U0010ffff.
\wMatch a word character. Word characters are
[\p{Alphabetic}\p{Mark}\p{Decimal_Number}\p{Connector_Punctuation}\u200c\u200d].
\WMatch a non-word character.
\x{hhhh} Match the character with hex value hhhh. From one to six hex digits may be supplied.
\xhhMatch the character with two digit hex value hh
\XMatch a Grapheme Cluster.
\ZMatch if the current position is at the end of input, but before the final line terminator, if one exists.
\zMatch if the current position is at the end of input.
\nBack Reference. Match whatever the nth capturing group matched. n must be a number > 1 and < total number of capture groups in the pattern.
\0oooMatch an Octal character. 'ooo' is from one to three
octal digits. 0377 is the largest allowed Octal character. The leading
zero is required; it distinguishes Octal constants from back references.
[pattern]Match any one character from the set.
.Match any character except for - by default - newline, compare stri_opts_regex.
^Match at the beginning of a line.
$Match at the end of a line.
\[outside of sets] Quotes the following character.
Characters that must be quoted to be treated as literals are
* ? + [ ( ) { } ^ $ | \ ..
\[inside sets] Quotes the following character.
Characters that must be quoted to be treated as literals are
[ ] \; Characters that may need to be quoted, depending
on the context are - &.
The syntax is similar, but not 100% compatible with the one described in about_search_charclass. In particular, whitespaces are not ignored and set-theoretic operations are denoted slightly differently. However, other than this about_search_charclass is a good reference on the capabilities offered.
The ICU User Guide on regexes lists what follows.
[abc]Match any of the characters a, b, or c
[^abc]Negation – match any character except a, b, or c
[A-M]Range – match any character from A to M (based on Unicode code point ordering)
[\p{L}], [\p{Letter}], [\p{General_Category=Letter}], [:letter:]
Characters with Unicode Category = Letter (4 equivalent forms)
[\P{Letter}]Negated property – natch everything except Letters
[\p{numeric_value=9}]Match all numbers with a numeric value of 9
[\p{Letter}&&\p{script=cyrillic}]Intersection; match the set of all Cyrillic letters
[\p{Letter}--\p{script=latin}]Set difference; match all non-Latin letters
[[a-z][A-Z][0-9]], [a-zA-Z0-9]
Union; match ASCII letters and digits (2 equivalent forms)
Note that if a given regex pattern is empty,
then all the functions in stringi give NA in result
and generate a warning.
On a syntax error, a quite informative failure message is shown.
If you wish to search for a fixed pattern, refer to about_search_coll or about_search_fixed. They allow to perform a locale-aware text lookup, or a very fast exact-byte search, respectively.
Marek Gagolewski and other contributors
Regular expressions – ICU User Guide, https://unicode-org.github.io/icu/userguide/strings/regexp.html
J.E.F. Friedl, Mastering Regular Expressions, O'Reilly, 2002
Unicode Regular Expressions – Unicode Technical Standard #18, https://www.unicode.org/reports/tr18/
Unicode Regular Expressions – Regex tutorial, https://www.regular-expressions.info/unicode.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_regex:
about_search,
stri_opts_regex()
Other stringi_general_topics:
about_arguments,
about_encoding,
about_locale,
about_search,
about_search_boundaries,
about_search_charclass,
about_search_coll,
about_search_fixed,
stringi-package
These functions may be used to determine if two strings are equal, canonically equivalent (this is performed in a much more clever fashion than when testing for equality), or to check whether they are in a specific lexicographic order.
stri_compare(e1, e2, ..., opts_collator = NULL) stri_cmp(e1, e2, ..., opts_collator = NULL) stri_cmp_eq(e1, e2) stri_cmp_neq(e1, e2) stri_cmp_equiv(e1, e2, ..., opts_collator = NULL) stri_cmp_nequiv(e1, e2, ..., opts_collator = NULL) stri_cmp_lt(e1, e2, ..., opts_collator = NULL) stri_cmp_gt(e1, e2, ..., opts_collator = NULL) stri_cmp_le(e1, e2, ..., opts_collator = NULL) stri_cmp_ge(e1, e2, ..., opts_collator = NULL)stri_compare(e1, e2, ..., opts_collator = NULL) stri_cmp(e1, e2, ..., opts_collator = NULL) stri_cmp_eq(e1, e2) stri_cmp_neq(e1, e2) stri_cmp_equiv(e1, e2, ..., opts_collator = NULL) stri_cmp_nequiv(e1, e2, ..., opts_collator = NULL) stri_cmp_lt(e1, e2, ..., opts_collator = NULL) stri_cmp_gt(e1, e2, ..., opts_collator = NULL) stri_cmp_le(e1, e2, ..., opts_collator = NULL) stri_cmp_ge(e1, e2, ..., opts_collator = NULL)
e1, e2
|
character vectors or objects coercible to character vectors |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
All the functions listed here are vectorized over e1 and e2.
stri_cmp_eq tests whether two corresponding strings
consist of exactly the same code points, while stri_cmp_neq allows
to check whether there is any difference between them. These are
locale-independent operations: for natural language processing,
where the notion of canonical equivalence is more valid, this might
not be exactly what you are looking for, see Examples.
Please note that stringi always silently removes UTF-8
BOMs from input strings, therefore, e.g., stri_cmp_eq does not take
BOMs into account while comparing strings.
stri_cmp_equiv tests for canonical equivalence of two strings
and is locale-dependent. Additionally, the ICU's Collator may be
tuned up so that, e.g., the comparison is case-insensitive.
To test whether two strings are not canonically equivalent,
call stri_cmp_nequiv.
stri_cmp_le tests whether
the elements in the first vector are less than or equal to
the corresponding elements in the second vector,
stri_cmp_ge tests whether they are greater or equal,
stri_cmp_lt if less, and stri_cmp_gt if greater,
see also, e.g., %s<%.
stri_compare is an alias to stri_cmp. They both
perform exactly the same locale-dependent operation.
Both functions provide a C library's strcmp() look-and-feel,
see Value for details.
For more information on ICU's Collator and how to tune its settings
refer to stri_opts_collator.
Note that different locale settings may lead to different results
(see the examples below).
The stri_cmp and stri_compare functions
return an integer vector representing the comparison results:
-1 if e1[...] < e2[...],
0 if they are canonically equivalent, and 1 if greater.
All the other functions return a logical vector that indicates
whether a given relation holds between two corresponding elements
in e1 and e2.
Marek Gagolewski and other contributors
Collation – ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
# in Polish, ch < h: stri_cmp_lt('hladny', 'chladny', locale='pl_PL') # in Slovak, ch > h: stri_cmp_lt('hladny', 'chladny', locale='sk_SK') # < or > (depends on locale): stri_cmp('hladny', 'chladny') # ignore case differences: stri_cmp_equiv('hladny', 'HLADNY', strength=2) # also ignore diacritical differences: stri_cmp_equiv('hladn\u00FD', 'hladny', strength=1, locale='sk_SK') marios <- c('Mario', 'mario', 'M\\u00e1rio', 'm\\u00e1rio') stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=2L) stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=1L) stri_cmp_equiv(marios, 'mario', strength=1L) stri_cmp_equiv(marios, 'mario', strength=2L) # non-Unicode-normalized vs normalized string: stri_cmp_equiv(stri_trans_nfkd('\u0105'), '\u105') # note the difference: stri_cmp_eq(stri_trans_nfkd('\u0105'), '\u105') # ligatures: stri_cmp_equiv('\ufb00', 'ff', strength=2) # phonebook collation stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE@collation=phonebook', strength=1L) stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE', strength=1L)# in Polish, ch < h: stri_cmp_lt('hladny', 'chladny', locale='pl_PL') # in Slovak, ch > h: stri_cmp_lt('hladny', 'chladny', locale='sk_SK') # < or > (depends on locale): stri_cmp('hladny', 'chladny') # ignore case differences: stri_cmp_equiv('hladny', 'HLADNY', strength=2) # also ignore diacritical differences: stri_cmp_equiv('hladn\u00FD', 'hladny', strength=1, locale='sk_SK') marios <- c('Mario', 'mario', 'M\\u00e1rio', 'm\\u00e1rio') stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=2L) stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=1L) stri_cmp_equiv(marios, 'mario', strength=1L) stri_cmp_equiv(marios, 'mario', strength=2L) # non-Unicode-normalized vs normalized string: stri_cmp_equiv(stri_trans_nfkd('\u0105'), '\u105') # note the difference: stri_cmp_eq(stri_trans_nfkd('\u0105'), '\u105') # ligatures: stri_cmp_equiv('\ufb00', 'ff', strength=2) # phonebook collation stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE@collation=phonebook', strength=1L) stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE', strength=1L)
These functions count the number of occurrences of a pattern in a string.
stri_count(str, ..., regex, fixed, coll, charclass) stri_count_charclass(str, pattern) stri_count_coll(str, pattern, ..., opts_collator = NULL) stri_count_fixed(str, pattern, ..., opts_fixed = NULL) stri_count_regex(str, pattern, ..., opts_regex = NULL)stri_count(str, ..., regex, fixed, coll, charclass) stri_count_charclass(str, pattern) stri_count_coll(str, pattern, ..., opts_collator = NULL) stri_count_fixed(str, pattern, ..., opts_fixed = NULL) stri_count_regex(str, pattern, ..., opts_regex = NULL)
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
opts_collator, opts_fixed, opts_regex
|
a named list used to tune up
the search engine's settings; see
|
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
If pattern is empty, then the result is NA
and a warning is generated.
stri_count is a convenience function.
It calls either stri_count_regex,
stri_count_fixed, stri_count_coll,
or stri_count_charclass, depending on the argument used.
All the functions return an integer vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_count:
about_search,
stri_count_boundaries()
s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' stri_count(s, fixed='dolor') stri_count(s, regex='\\p{L}+') stri_count_fixed(s, ' ') stri_count_fixed(s, 'o') stri_count_fixed(s, 'it') stri_count_fixed(s, letters) stri_count_fixed('babab', 'b') stri_count_fixed(c('stringi', '123'), 'string') stri_count_charclass(c('stRRRingi', 'STrrrINGI', '123'), c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) stri_count_charclass(' \t\n', '\\p{WHITE_SPACE}') # white space - binary property stri_count_charclass(' \t\n', '\\p{Z}') # white-space - general category (note the difference) stri_count_regex(s, '(s|el)it') stri_count_regex(s, 'i.i') stri_count_regex(s, '.it') stri_count_regex('bab baab baaab', c('b.*?b', 'b.b')) stri_count_regex(c('stringi', '123'), '^(s|1)')s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' stri_count(s, fixed='dolor') stri_count(s, regex='\\p{L}+') stri_count_fixed(s, ' ') stri_count_fixed(s, 'o') stri_count_fixed(s, 'it') stri_count_fixed(s, letters) stri_count_fixed('babab', 'b') stri_count_fixed(c('stringi', '123'), 'string') stri_count_charclass(c('stRRRingi', 'STrrrINGI', '123'), c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) stri_count_charclass(' \t\n', '\\p{WHITE_SPACE}') # white space - binary property stri_count_charclass(' \t\n', '\\p{Z}') # white-space - general category (note the difference) stri_count_regex(s, '(s|el)it') stri_count_regex(s, 'i.i') stri_count_regex(s, '.it') stri_count_regex('bab baab baaab', c('b.*?b', 'b.b')) stri_count_regex(c('stringi', '123'), '^(s|1)')
These functions determine the number of text boundaries (like character, word, line, or sentence boundaries) in a string.
stri_count_boundaries(str, ..., opts_brkiter = NULL) stri_count_words(str, locale = NULL)stri_count_boundaries(str, ..., opts_brkiter = NULL) stri_count_words(str, locale = NULL)
str |
character vector or an object coercible to |
... |
additional settings for |
opts_brkiter |
a named list with ICU BreakIterator's settings,
see |
locale |
|
Vectorized over str.
For more information on text boundary analysis
performed by ICU's BreakIterator, see
stringi-search-boundaries.
In case of stri_count_words,
just like in stri_extract_all_words and
stri_locate_all_words,
ICU's word BreakIterator iterator is used
to locate the word boundaries, and all non-word characters
(UBRK_WORD_NONE rule status) are ignored.
This function is equivalent to a call to
stri_count_boundaries(str, type='word', skip_word_none=TRUE, locale=locale).
Note that a BreakIterator of type character
may be used to count the number of Unicode characters in a string.
The stri_length function,
which aims to count the number of Unicode code points,
might report different results.
Moreover, a BreakIterator of type sentence
may be used to count the number of sentences in a text piece.
Both functions return an integer vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_count:
about_search,
stri_count()
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' stri_count_boundaries(test, type='word') stri_count_boundaries(test, type='sentence') stri_count_boundaries(test, type='character') stri_count_words(test) test2 <- stri_trans_nfkd('\u03c0\u0153\u0119\u00a9\u00df\u2190\u2193\u2192') stri_count_boundaries(test2, type='character') stri_length(test2) stri_numbytes(test2)test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' stri_count_boundaries(test, type='word') stri_count_boundaries(test, type='sentence') stri_count_boundaries(test, type='character') stri_count_words(test) test2 <- stri_trans_nfkd('\u03c0\u0153\u0119\u00a9\u00df\u2190\u2193\u2192') stri_count_boundaries(test2, type='character') stri_length(test2) stri_numbytes(test2)
Modifies a date-time object by adding a specific amount of time units.
stri_datetime_add( time, value = 1L, units = "seconds", tz = NULL, locale = NULL ) stri_datetime_add(time, units = "seconds", tz = NULL, locale = NULL) <- valuestri_datetime_add( time, value = 1L, units = "seconds", tz = NULL, locale = NULL ) stri_datetime_add(time, units = "seconds", tz = NULL, locale = NULL) <- value
time |
an object of class |
value |
integer vector; signed number of units to add to |
units |
single string; one of |
tz |
|
locale |
|
Vectorized over time and value.
Note that, e.g., January, 31 + 1 month = February, 28 or 29.
Both functions return an object of class POSIXct.
The replacement version of stri_datetime_add modifies
the state of the time object.
Marek Gagolewski and other contributors
Calendar Classes - ICU User Guide, https://unicode-org.github.io/icu/userguide/datetime/calendar/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
x <- stri_datetime_now() print(x) stri_datetime_add(x, units='months') <- 2 print(x) x <- stri_datetime_create(2025, 4, 20) print(x) stri_datetime_add(x, -2, units='months') stri_datetime_add(x, 1, units='years') stri_datetime_add(x, 1, units='years', locale='@calendar=hebrew') stri_datetime_add(stri_datetime_create(2024, 1, 31), 1, units='months')x <- stri_datetime_now() print(x) stri_datetime_add(x, units='months') <- 2 print(x) x <- stri_datetime_create(2025, 4, 20) print(x) stri_datetime_add(x, -2, units='months') stri_datetime_add(x, 1, units='years') stri_datetime_add(x, 1, units='years', locale='@calendar=hebrew') stri_datetime_add(stri_datetime_create(2024, 1, 31), 1, units='months')
Constructs date-time objects from numeric representations.
stri_datetime_create( year = NULL, month = NULL, day = NULL, hour = 0L, minute = 0L, second = 0, lenient = FALSE, tz = NULL, locale = NULL )stri_datetime_create( year = NULL, month = NULL, day = NULL, hour = 0L, minute = 0L, second = 0, lenient = FALSE, tz = NULL, locale = NULL )
year |
integer vector; 0 is 1BCE, -1 is 2BCE, etc.;
|
month |
integer vector; months are 1-based;
|
day |
integer vector;
|
hour |
integer vector;
|
minute |
integer vector;
|
second |
numeric vector; fractional seconds are allowed;
|
lenient |
single logical value; should the operation be lenient? |
tz |
|
locale |
|
Vectorized over year, month, day, hour,
hour, minute, and second.
Returns an object of class POSIXct.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
stri_datetime_create(2015, 12, 31, 23, 59, 59.999) stri_datetime_create(5775, 8, 1, locale='@calendar=hebrew') # 1 Nisan 5775 -> 2015-03-21 stri_datetime_create(2015, 02, 29) stri_datetime_create(2015, 02, 29, lenient=TRUE) stri_datetime_create(hour=15, minute=59)stri_datetime_create(2015, 12, 31, 23, 59, 59.999) stri_datetime_create(5775, 8, 1, locale='@calendar=hebrew') # 1 Nisan 5775 -> 2015-03-21 stri_datetime_create(2015, 02, 29) stri_datetime_create(2015, 02, 29, lenient=TRUE) stri_datetime_create(hour=15, minute=59)
Computes and returns values for all date and time fields.
stri_datetime_fields(time, tz = attr(time, "tzone"), locale = NULL)stri_datetime_fields(time, tz = attr(time, "tzone"), locale = NULL)
time |
an object of class |
tz |
|
locale |
|
Vectorized over time.
Returns a data frame with the following columns:
Year (0 is 1BC, -1 is 2BC, etc.)
Month (1-based, i.e., 1 stands for the first month, e.g., January;
note that the number of months depends on the selected calendar,
see stri_datetime_symbols)
Day
Hour (24-h clock)
Minute
Second
Millisecond
WeekOfYear (this is locale-dependent)
WeekOfMonth (this is locale-dependent)
DayOfYear
DayOfWeek (1-based, 1 denotes Sunday; see stri_datetime_symbols)
Hour12 (12-h clock)
AmPm (see stri_datetime_symbols)
Era (see stri_datetime_symbols)
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
stri_datetime_fields(stri_datetime_now()) stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew') stri_datetime_symbols(locale='@calendar=hebrew')$Month[ stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew')$Month ]stri_datetime_fields(stri_datetime_now()) stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew') stri_datetime_symbols(locale='@calendar=hebrew')$Month[ stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew')$Month ]
These functions convert a given date/time object to a character vector, or vice versa.
stri_datetime_format( time, format = "uuuu-MM-dd HH:mm:ss", tz = NULL, locale = NULL ) stri_datetime_parse( str, format = "uuuu-MM-dd HH:mm:ss", lenient = FALSE, tz = NULL, locale = NULL )stri_datetime_format( time, format = "uuuu-MM-dd HH:mm:ss", tz = NULL, locale = NULL ) stri_datetime_parse( str, format = "uuuu-MM-dd HH:mm:ss", lenient = FALSE, tz = NULL, locale = NULL )
time |
an object of class |
format |
character vector, see Details; see also |
tz |
|
locale |
|
str |
character vector with strings to be parsed |
lenient |
single logical value; should date/time parsing be lenient? |
Vectorized over format and time or str.
When parsing strings, unspecified date-time fields
(e.g., seconds where only hours and minutes are given)
are based on today's midnight in the local time zone
(for compatibility with strptime).
By default, stri_datetime_format (for compatibility
with the strftime function)
formats a date/time object using the current default time zone.
format may be one of DT_STYLE or DT_relative_STYLE,
where DT is equal to date, time, or datetime,
and STYLE is equal to full, long, medium,
or short. This gives a locale-dependent date and/or time format.
Note that currently ICU does not support relative
time formats, thus this flag is currently ignored in such a context.
Otherwise, format is a pattern:
a string where specific sequences of characters are replaced
with date/time data from a calendar when formatting or used
to generate data for a calendar when parsing.
For example, y stands for 'year'. Characters
may be used multiple times:
yy might produce 99, whereas yyyy yields 1999.
For most numerical fields, the number of characters specifies
the field width. For example, if h is the hour, h might
produce 5, but hh yields 05.
For some characters, the count specifies whether an abbreviated
or full form should be used.
Two single quotes represent a literal single quote, either
inside or outside single quotes. Text within single quotes
is not interpreted in any way (except for two adjacent single quotes).
Otherwise, all ASCII letters from a to z and
A to Z are reserved as syntax characters, and require quoting
if they are to represent literal characters. In addition, certain
ASCII punctuation characters may become available in the future
(e.g., : being interpreted as the time separator and /
as a date separator, and replaced by respective
locale-sensitive characters in display).
| Symbol | Meaning | Example(s) | Output |
| G | era designator | G, GG, or GGG | AD |
| GGGG | Anno Domini | ||
| GGGGG | A | ||
| y | year | yy | 96 |
| y or yyyy | 1996 | ||
| u | extended year | u | 4601 |
| U | cyclic year name, as in Chinese lunar calendar | U | |
| r | related Gregorian year | r | 1996 |
| Q | quarter | Q or QQ | 02 |
| QQQ | Q2 | ||
| QQQQ | 2nd quarter | ||
| QQQQQ | 2 | ||
| q | Stand Alone quarter | q or qq | 02 |
| qqq | Q2 | ||
| qqqq | 2nd quarter | ||
| qqqqq | 2 | ||
| M | month in year | M or MM | 09 |
| MMM | Sep | ||
| MMMM | September | ||
| MMMMM | S | ||
| L | Stand Alone month in year | L or LL | 09 |
| LLL | Sep | ||
| LLLL | September | ||
| LLLLL | S | ||
| w | week of year | w or ww | 27 |
| W | week of month | W | 2 |
| d | day in month | d | 2 |
| dd | 02 | ||
| D | day of year | D | 189 |
| F | day of week in month | F | 2 (2nd Wed in July) |
| g | modified Julian day | g | 2451334 |
| E | day of week | E, EE, or EEE | Tue |
| EEEE | Tuesday | ||
| EEEEE | T | ||
| EEEEEE | Tu | ||
| e | local day of week | e or ee | 2 |
| example: if Monday is 1st day, Tuesday is 2nd ) | eee | Tue | |
| eeee | Tuesday | ||
| eeeee | T | ||
| eeeeee | Tu | ||
| c | Stand Alone local day of week | c or cc | 2 |
| ccc | Tue | ||
| cccc | Tuesday | ||
| ccccc | T | ||
| cccccc | Tu | ||
| a | am/pm marker | a | pm |
| h | hour in am/pm (1~12) | h | 7 |
| hh | 07 | ||
| H | hour in day (0~23) | H | 0 |
| HH | 00 | ||
| k | hour in day (1~24) | k | 24 |
| kk | 24 | ||
| K | hour in am/pm (0~11) | K | 0 |
| KK | 00 | ||
| m | minute in hour | m | 4 |
| mm | 04 | ||
| s | second in minute | s | 5 |
| ss | 05 | ||
| S | fractional second - truncates (like other time fields) | S | 2 |
| to the count of letters when formatting. Appends | SS | 23 | |
| zeros if more than 3 letters specified. Truncates at | SSS | 235 | |
| three significant digits when parsing. | SSSS | 2350 | |
| A | milliseconds in day | A | 61201235 |
| z | Time Zone: specific non-location | z, zz, or zzz | PDT |
| zzzz | Pacific Daylight Time | ||
| Z | Time Zone: ISO8601 basic hms? / RFC 822 | Z, ZZ, or ZZZ | -0800 |
| Time Zone: long localized GMT (=OOOO) | ZZZZ | GMT-08:00 | |
| Time Zone: ISO8601 extended hms? (=XXXXX) | ZZZZZ | -08:00, -07:52:58, Z | |
| O | Time Zone: short localized GMT | O | GMT-8 |
| Time Zone: long localized GMT (=ZZZZ) | OOOO | GMT-08:00 | |
| v | Time Zone: generic non-location | v | PT |
| (falls back first to VVVV) | vvvv | Pacific Time or Los Angeles Time | |
| V | Time Zone: short time zone ID | V | uslax |
| Time Zone: long time zone ID | VV | America/Los_Angeles | |
| Time Zone: time zone exemplar city | VVV | Los Angeles | |
| Time Zone: generic location (falls back to OOOO) | VVVV | Los Angeles Time | |
| X | Time Zone: ISO8601 basic hm?, with Z for 0 | X | -08, +0530, Z |
| Time Zone: ISO8601 basic hm, with Z | XX | -0800, Z | |
| Time Zone: ISO8601 extended hm, with Z | XXX | -08:00, Z | |
| Time Zone: ISO8601 basic hms?, with Z | XXXX | -0800, -075258, Z | |
| Time Zone: ISO8601 extended hms?, with Z | XXXXX | -08:00, -07:52:58, Z | |
| x | Time Zone: ISO8601 basic hm?, without Z for 0 | x | -08, +0530 |
| Time Zone: ISO8601 basic hm, without Z | xx | -0800 | |
| Time Zone: ISO8601 extended hm, without Z | xxx | -08:00 | |
| Time Zone: ISO8601 basic hms?, without Z | xxxx | -0800, -075258 | |
| Time Zone: ISO8601 extended hms?, without Z | xxxxx | -08:00, -07:52:58 | |
| ' | escape for text | ' | (nothing) |
| ' ' | two single quotes produce one | ' ' | ' |
Note that any characters in the pattern that are not in the ranges
of [a-z] and [A-Z] will be treated as quoted text.
For instance, characters like :, ., (a space),
# and @ will appear in the resulting time text
even if they are not enclosed within single quotes. The single quote is used
to “escape” the letters. Two single quotes in a row,
inside or outside a quoted sequence, represent a “real” single quote.
A few examples:
| Example Pattern | Result |
| yyyy.MM.dd 'at' HH:mm:ss zzz | 2015.12.31 at 23:59:59 GMT+1 |
| EEE, MMM d, ''yy | czw., gru 31, '15 |
| h:mm a | 11:59 PM |
| hh 'o''clock' a, zzzz | 11 o'clock PM, GMT+01:00 |
| K:mm a, z | 11:59 PM, GMT+1 |
| yyyyy.MMMM.dd GGG hh:mm aaa | 2015.grudnia.31 n.e. 11:59 PM |
| uuuu-MM-dd'T'HH:mm:ssZ | 2015-12-31T23:59:59+0100 (the ISO 8601 guideline) |
stri_datetime_format returns a character vector.
stri_datetime_parse returns an object of class POSIXct.
Marek Gagolewski and other contributors
Formatting Dates and Times – ICU User Guide, https://unicode-org.github.io/icu/userguide/format_parse/datetime/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
x <- c('2015-02-28', '2015-02-29') stri_datetime_parse(x, 'yyyy-MM-dd') stri_datetime_parse(x, 'yyyy-MM-dd', lenient=TRUE) stri_datetime_parse(x %s+% " 17:13", "yyyy-MM-dd HH:mm") stri_datetime_parse('19 lipca 2015', 'date_long', locale='pl_PL') stri_datetime_format(stri_datetime_now(), 'datetime_relative_medium')x <- c('2015-02-28', '2015-02-29') stri_datetime_parse(x, 'yyyy-MM-dd') stri_datetime_parse(x, 'yyyy-MM-dd', lenient=TRUE) stri_datetime_parse(x %s+% " 17:13", "yyyy-MM-dd HH:mm") stri_datetime_parse('19 lipca 2015', 'date_long', locale='pl_PL') stri_datetime_format(stri_datetime_now(), 'datetime_relative_medium')
strptime-Style Format StringsThis function converts strptime or
strftime-style
format strings to ICU format strings that may be used
in stri_datetime_parse and stri_datetime_format
functions.
stri_datetime_fstr(x, ignore_special = TRUE)stri_datetime_fstr(x, ignore_special = TRUE)
x |
character vector of date/time format strings |
ignore_special |
if |
For more details on conversion specifiers please refer to
the manual page of strptime. Most of the formatters
of the form %x, where x is a letter, are supported.
Moreover, each %% is replaced with %.
Warnings are given in the case of %x, %X, %u,
%w, %g, %G, %c, %U, and %W
as in such circumstances either ICU does not
support the functionality requested using the string format API
or there are some inconsistencies between base R and ICU.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
stri_datetime_fstr('%Y-%m-%d %H:%M:%S')stri_datetime_fstr('%Y-%m-%d %H:%M:%S')
Returns the current date and time.
stri_datetime_now()stri_datetime_now()
The current date and time in stringi is represented as the (signed) number of seconds since 1970-01-01 00:00:00 UTC. UTC leap seconds are ignored.
Returns an object of class POSIXct.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
Returns a list of all localizable date-time formatting data, including month and weekday names, localized AM/PM strings, etc.
stri_datetime_symbols(locale = NULL, context = "standalone", width = "wide")stri_datetime_symbols(locale = NULL, context = "standalone", width = "wide")
locale |
|
context |
single string; one of: |
width |
single string; one of: |
context stands for a selector for date formatting context
and width - for date formatting width.
Returns a list with the following named components:
Month - month names,
Weekday - weekday names,
Quarter - quarter names,
AmPm - AM/PM names,
Era - era names.
Marek Gagolewski and other contributors
Calendar - ICU User Guide, https://unicode-org.github.io/icu/userguide/datetime/calendar/
DateFormatSymbols class – ICU API Documentation, https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/classicu_1_1DateFormatSymbols.html
Formatting Dates and Times – ICU User Guide, https://unicode-org.github.io/icu/userguide/format_parse/datetime/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_timezone_get(),
stri_timezone_info(),
stri_timezone_list()
stri_datetime_symbols() # uses the Gregorian calendar in most locales stri_datetime_symbols('@calendar=hebrew') stri_datetime_symbols('he_IL@calendar=hebrew') stri_datetime_symbols('@calendar=islamic') stri_datetime_symbols('@calendar=persian') stri_datetime_symbols('@calendar=indian') stri_datetime_symbols('@calendar=coptic') stri_datetime_symbols('@calendar=japanese') stri_datetime_symbols('ja_JP_TRADITIONAL') # uses the Japanese calendar by default stri_datetime_symbols('th_TH_TRADITIONAL') # uses the Buddhist calendar stri_datetime_symbols('pl_PL', context='format') stri_datetime_symbols('pl_PL', context='standalone') stri_datetime_symbols(width='wide') stri_datetime_symbols(width='abbreviated') stri_datetime_symbols(width='narrow')stri_datetime_symbols() # uses the Gregorian calendar in most locales stri_datetime_symbols('@calendar=hebrew') stri_datetime_symbols('he_IL@calendar=hebrew') stri_datetime_symbols('@calendar=islamic') stri_datetime_symbols('@calendar=persian') stri_datetime_symbols('@calendar=indian') stri_datetime_symbols('@calendar=coptic') stri_datetime_symbols('@calendar=japanese') stri_datetime_symbols('ja_JP_TRADITIONAL') # uses the Japanese calendar by default stri_datetime_symbols('th_TH_TRADITIONAL') # uses the Buddhist calendar stri_datetime_symbols('pl_PL', context='format') stri_datetime_symbols('pl_PL', context='standalone') stri_datetime_symbols(width='wide') stri_datetime_symbols(width='abbreviated') stri_datetime_symbols(width='narrow')
These functions determine, for each string in str,
if there is at least one match to a corresponding pattern.
stri_detect(str, ..., regex, fixed, coll, charclass) stri_detect_fixed( str, pattern, negate = FALSE, max_count = -1, ..., opts_fixed = NULL ) stri_detect_charclass(str, pattern, negate = FALSE, max_count = -1) stri_detect_coll( str, pattern, negate = FALSE, max_count = -1, ..., opts_collator = NULL ) stri_detect_regex( str, pattern, negate = FALSE, max_count = -1, ..., opts_regex = NULL )stri_detect(str, ..., regex, fixed, coll, charclass) stri_detect_fixed( str, pattern, negate = FALSE, max_count = -1, ..., opts_fixed = NULL ) stri_detect_charclass(str, pattern, negate = FALSE, max_count = -1) stri_detect_coll( str, pattern, negate = FALSE, max_count = -1, ..., opts_collator = NULL ) stri_detect_regex( str, pattern, negate = FALSE, max_count = -1, ..., opts_regex = NULL )
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
negate |
single logical value; whether a no-match to a pattern is rather of interest |
max_count |
single integer; allows to stop searching once a given
number of occurrences is detected; |
opts_collator, opts_fixed, opts_regex
|
a named list used to tune up
the search engine's settings; see
|
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
If pattern is empty, then the result is NA
and a warning is generated.
stri_detect is a convenience function.
It calls either stri_detect_regex,
stri_detect_fixed, stri_detect_coll,
or stri_detect_charclass, depending on the argument used.
See also stri_startswith and stri_endswith
for testing whether a string starts or ends with a match to a given pattern.
Moreover, see stri_subset for a character vector subsetting.
If max_count is negative, then all stings are examined.
Otherwise, searching terminates
once max_count matches (or, if negate is TRUE,
no-matches) are detected. The uninspected cases are marked
as missing in the return vector. Be aware that, unless pattern is a
singleton, the elements in str might be inspected in a
non-consecutive order.
Each function returns a logical vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_detect:
about_search,
stri_startswith()
stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), c('i', 'R', '0')) stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), 'R') stri_detect_charclass(c('stRRRingi','R STRINGI', '123'), c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) stri_detect_regex(c('stringi R', 'R STRINGI', '123'), 'R.') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[[:alpha:]]*?') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[a-zC1]') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '( R|RE)') stri_detect_regex('stringi', 'STRING.', case_insensitive=TRUE) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', max_count=1) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', max_count=2) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', negate=TRUE, max_count=3)stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), c('i', 'R', '0')) stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), 'R') stri_detect_charclass(c('stRRRingi','R STRINGI', '123'), c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) stri_detect_regex(c('stringi R', 'R STRINGI', '123'), 'R.') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[[:alpha:]]*?') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[a-zC1]') stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '( R|RE)') stri_detect_regex('stringi', 'STRING.', case_insensitive=TRUE) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', max_count=1) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', max_count=2) stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), '^[0-9]+$', negate=TRUE, max_count=3)
Duplicates each str(e1) string times(e2) times
and concatenates the results.
stri_dup(str, times) e1 %s*% e2 e1 %stri*% e2stri_dup(str, times) e1 %s*% e2 e1 %stri*% e2
str, e1
|
a character vector of strings to be duplicated |
times, e2
|
an integer vector with the numbers of times to duplicate each string |
Vectorized over all arguments.
e1 %s*% e2 and e1 %stri*% e2 are synonyms
for stri_dup(e1, e2)
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other join:
%s+%(),
stri_flatten(),
stri_join(),
stri_join_list()
stri_dup('a', 1:5) stri_dup(c('a', NA, 'ba'), 4) stri_dup(c('abc', 'pqrst'), c(4, 2)) "a" %s*% 5stri_dup('a', 1:5) stri_dup(c('a', NA, 'ba'), 4) stri_dup(c('abc', 'pqrst'), c(4, 2)) "a" %s*% 5
stri_duplicated() determines which strings in a character vector
are duplicates of other elements.
stri_duplicated_any() determines if there are any duplicated
strings in a character vector.
stri_duplicated( str, from_last = FALSE, fromLast = from_last, ..., opts_collator = NULL ) stri_duplicated_any( str, from_last = FALSE, fromLast = from_last, ..., opts_collator = NULL )stri_duplicated( str, from_last = FALSE, fromLast = from_last, ..., opts_collator = NULL ) stri_duplicated_any( str, from_last = FALSE, fromLast = from_last, ..., opts_collator = NULL )
str |
a character vector |
from_last |
a single logical value; indicates whether search should be performed from the last to the first string |
fromLast |
[DEPRECATED] alias of |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
Missing values are regarded as equal.
Unlike duplicated and anyDuplicated,
these functions test for canonical equivalence of strings
(and not whether the strings are just bytewise equal)
Such operations are locale-dependent.
Hence, stri_duplicated and stri_duplicated_any
are significantly slower (but much better suited for natural language
processing) than their base R counterparts.
See also stri_unique for extracting unique elements.
stri_duplicated() returns a logical vector of the same length
as str. Each of its elements indicates whether a canonically
equivalent string was already found in str.
stri_duplicated_any() returns a single non-negative integer.
Value of 0 indicates that all the elements in str are unique.
Otherwise, it gives the index of the first non-unique element.
Marek Gagolewski and other contributors
Collation - ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
# In the following examples, we have 3 duplicated values, # 'a' - 2 times, NA - 1 time stri_duplicated(c('a', 'b', 'a', NA, 'a', NA)) stri_duplicated(c('a', 'b', 'a', NA, 'a', NA), from_last=TRUE) stri_duplicated_any(c('a', 'b', 'a', NA, 'a', NA)) # compare the results: stri_duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) stri_duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1) duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'))# In the following examples, we have 3 duplicated values, # 'a' - 2 times, NA - 1 time stri_duplicated(c('a', 'b', 'a', NA, 'a', NA)) stri_duplicated(c('a', 'b', 'a', NA, 'a', NA), from_last=TRUE) stri_duplicated_any(c('a', 'b', 'a', NA, 'a', NA)) # compare the results: stri_duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) stri_duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1) duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'))
This function uses the ICU engine to determine the character set, or encoding, of character data in an unknown format.
stri_enc_detect(str, filter_angle_brackets = FALSE)stri_enc_detect(str, filter_angle_brackets = FALSE)
str |
character vector, a raw vector, or
a list of |
filter_angle_brackets |
logical; If filtering is enabled, text within angle brackets ('<' and '>') will be removed before detection, which will remove most HTML or XML markup. |
Vectorized over str and filter_angle_brackets.
For a character vector input, merging all text lines
via stri_flatten(str, collapse='\n')
might be needed if str has been obtained via a call to
readLines and in fact represents an image of a single text file.
This is, at best, an imprecise operation using statistics and heuristics. Because of this, detection works best if you supply at least a few hundred bytes of character data that is mostly in a single language. However, because the detection only looks at a limited amount of the input data, some of the returned character sets may fail to handle all of the input data. Note that in some cases, the language can be determined along with the encoding.
Several different techniques are used for character set detection. For multi-byte encodings, the sequence of bytes is checked for legible patterns. The detected characters are also checked against a list of frequently used characters in that encoding. For single byte encodings, the data is checked against a list of the most commonly occurring three letter groups for each language that can be written using that encoding.
The detection process can be configured to optionally ignore HTML or XML style markup (using ICU's internal facilities), which can interfere with the detection process by changing the statistics.
This function should most often be used for byte-marked input strings,
especially after loading them from text files and before the main
conversion with stri_encode.
The input encoding is of course not taken into account here, even
if marked.
The following table shows all the encodings that can be detected:
| Character_Set | Languages |
| UTF-8 | -- |
| UTF-16BE | -- |
| UTF-16LE | -- |
| UTF-32BE | -- |
| UTF-32LE | -- |
| Shift_JIS | Japanese |
| ISO-2022-JP | Japanese |
| ISO-2022-CN | Simplified Chinese |
| ISO-2022-KR | Korean |
| GB18030 | Chinese |
| Big5 | Traditional Chinese |
| EUC-JP | Japanese |
| EUC-KR | Korean |
| ISO-8859-1 | Danish, Dutch, English, French, German, Italian, Norwegian, Portuguese, Swedish |
| ISO-8859-2 | Czech, Hungarian, Polish, Romanian |
| ISO-8859-5 | Russian |
| ISO-8859-6 | Arabic |
| ISO-8859-7 | Greek |
| ISO-8859-8 | Hebrew |
| ISO-8859-9 | Turkish |
| windows-1250 | Czech, Hungarian, Polish, Romanian |
| windows-1251 | Russian |
| windows-1252 | Danish, Dutch, English, French, German, Italian, Norwegian, Portuguese, Swedish |
| windows-1253 | Greek |
| windows-1254 | Turkish |
| windows-1255 | Hebrew |
| windows-1256 | Arabic |
| KOI8-R | Russian |
| IBM420 | Arabic |
| IBM424 | Hebrew |
Returns a list of length equal to the length of str.
Each list element is a data frame with the following three named vectors
representing all the guesses:
Encoding – string; guessed encodings; NA on failure,
Language – string; guessed languages; NA if the language could
not be determined (e.g., in case of UTF-8),
Confidence – numeric in [0,1]; the higher the value,
the more confidence there is in the match; NA on failure.
The guesses are ordered by decreasing confidence.
Marek Gagolewski and other contributors
Character Set Detection – ICU User Guide, https://unicode-org.github.io/icu/userguide/conversion/detection.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_detection:
about_encoding,
stri_enc_detect2(),
stri_enc_isascii(),
stri_enc_isutf16be(),
stri_enc_isutf8()
## Not run: ## f <- rawToChar(readBin('test.txt', 'raw', 100000)) ## stri_enc_detect(f)## Not run: ## f <- rawToChar(readBin('test.txt', 'raw', 100000)) ## stri_enc_detect(f)
This function tries to detect character encoding in case the language of text is known.
stri_enc_detect2(str, locale = NULL)stri_enc_detect2(str, locale = NULL)
str |
character vector, a raw vector, or
a list of |
locale |
|
Vectorized over str.
First, the text is checked whether it is valid
UTF-32BE, UTF-32LE, UTF-16BE, UTF-16LE, UTF-8
(as in stri_enc_detect,
this is roughly inspired by ICU's i18n/csrucode.cpp) or ASCII.
If locale is not NA and the above fails,
the text is checked for the number of occurrences
of language-specific code points (data provided by the ICU library)
converted to all possible 8-bit encodings
that fully cover the indicated language.
The encoding is selected based on the greatest number of total
byte hits.
The guess is of course imprecise, as it is obtained using statistics and heuristics. Because of this, detection works best if you supply at least a few hundred bytes of character data that is in a single language.
If you have no initial guess on the language and encoding, try with
stri_enc_detect (uses ICU facilities).
Just like stri_enc_detect,
this function returns a list of length equal to the length of str.
Each list element is a data frame with the following three named components:
Encoding – string; guessed encodings; NA on failure
(if and only if encodings is empty),
Language – always NA,
Confidence – numeric in [0,1]; the higher the value,
the more confidence there is in the match; NA on failure.
The guesses are ordered by decreasing confidence.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other encoding_detection:
about_encoding,
stri_enc_detect(),
stri_enc_isascii(),
stri_enc_isutf16be(),
stri_enc_isutf8()
This function converts integer vectors, representing sequences of UTF-32 code points, to UTF-8 strings.
stri_enc_fromutf32(vec)stri_enc_fromutf32(vec)
vec |
a list of integer vectors (or objects coercible to such vectors)
or |
UTF-32 is a 32-bit encoding where each Unicode code point corresponds to exactly one integer value.
This function is a vectorized version of
intToUtf8. As usual in stringi,
it returns character strings in UTF-8.
See stri_enc_toutf32 for a dual operation.
If an ill-defined code point is given, a warning is generated
and the corresponding string is set to NA.
Note that 0s are not allowed in vec, as they are used
internally to mark the end of a string (in the C API).
See also stri_encode for decoding arbitrary byte sequences
from any given encoding.
Returns a character vector (in UTF-8).
NULLs in the input list are converted to NA_character_.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_toascii(),
stri_enc_tonative(),
stri_enc_toutf32(),
stri_enc_toutf8(),
stri_encode()
Gets basic information on a character encoding.
stri_enc_info(enc = NULL)stri_enc_info(enc = NULL)
enc |
|
An error is raised if the provided encoding is unknown to ICU
(see stri_enc_list for more details).
Returns a list with the following components:
Name.friendly – friendly encoding name:
MIME Name or JAVA Name or ICU Canonical Name
(the first of provided ones is selected, see below);
Name.ICU – encoding name as identified by ICU;
Name.* – other standardized encoding names,
e.g., Name.UTR22, Name.IBM, Name.WINDOWS,
Name.JAVA, Name.IANA, Name.MIME (some of them
may be unavailable for all the encodings);
ASCII.subset – is ASCII a subset of the given encoding?;
Unicode.1to1 – for 8-bit encodings only: are all characters
translated to exactly one Unicode code point and is the translation
scheme reversible?;
CharSize.8bit – is this an 8-bit encoding, i.e., do we have
CharSize.min == CharSize.max and CharSize.min == 1?;
CharSize.min – minimal number of bytes used
to represent a UChar (in UTF-16, this is not the same as UChar32)
CharSize.max – maximal number of bytes used
to represent a UChar (in UTF-16, this is not the same as UChar32,
i.e., does not reflect the maximal code point representation size)
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_management:
about_encoding,
stri_enc_list(),
stri_enc_mark(),
stri_enc_set()
The function checks whether all bytes in a string are <= 127.
stri_enc_isascii(str)stri_enc_isascii(str)
str |
character vector, a raw vector, or
a list of |
This function is independent of the way R marks encodings in character strings (see Encoding and stringi-encoding).
Returns a logical vector. The i-th element indicates whether the i-th string corresponds to a valid ASCII byte sequence.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_detection:
about_encoding,
stri_enc_detect(),
stri_enc_detect2(),
stri_enc_isutf16be(),
stri_enc_isutf8()
stri_enc_isascii(letters[1:3]) stri_enc_isascii('\u0105\u0104')stri_enc_isascii(letters[1:3]) stri_enc_isascii('\u0105\u0104')
These functions detect whether a given byte stream is valid UTF-16LE, UTF-16BE, UTF-32LE, or UTF-32BE.
stri_enc_isutf16be(str) stri_enc_isutf16le(str) stri_enc_isutf32be(str) stri_enc_isutf32le(str)stri_enc_isutf16be(str) stri_enc_isutf16le(str) stri_enc_isutf32be(str) stri_enc_isutf32le(str)
str |
character vector, a raw vector, or
a list of |
These functions are independent of the way R marks encodings in character strings (see Encoding and stringi-encoding). Most often, these functions act on raw vectors.
A result of FALSE means that a string is surely not valid UTF-16
or UTF-32. However, false positives are possible.
Also note that a data stream may be sometimes classified as both valid UTF-16LE and UTF-16BE.
Returns a logical vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_detection:
about_encoding,
stri_enc_detect(),
stri_enc_detect2(),
stri_enc_isascii(),
stri_enc_isutf8()
The function checks whether given sequences of bytes forms a proper UTF-8 string.
stri_enc_isutf8(str)stri_enc_isutf8(str)
str |
character vector, a raw vector, or
a list of |
FALSE means that a string is certainly not valid UTF-8.
However, false positives are possible. For instance,
(c4,85) represents ('a with ogonek') in UTF-8
as well as ('A umlaut', 'Ellipsis') in WINDOWS-1250.
Also note that UTF-8, as well as most 8-bit encodings, extend ASCII
(note that stri_enc_isascii implies that
stri_enc_isutf8).
However, the longer the sequence, the greater the possibility that the result is indeed in UTF-8 – this is because not all sequences of bytes are valid UTF-8.
This function is independent of the way R marks encodings in character strings (see Encoding and stringi-encoding).
Returns a logical vector. Its i-th element indicates whether the i-th string corresponds to a valid UTF-8 byte sequence.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_detection:
about_encoding,
stri_enc_detect(),
stri_enc_detect2(),
stri_enc_isascii(),
stri_enc_isutf16be()
stri_enc_isutf8(letters[1:3]) stri_enc_isutf8('\u0105\u0104') stri_enc_isutf8('\u1234\u0222')stri_enc_isutf8(letters[1:3]) stri_enc_isutf8('\u0105\u0104') stri_enc_isutf8('\u1234\u0222')
Gives the list of encodings that are supported by ICU.
stri_enc_list(simplify = TRUE)stri_enc_list(simplify = TRUE)
simplify |
single logical value; return a character vector or a list of character vectors? |
Apart from given encoding identifiers and their aliases,
some other specifiers might additionally be available.
This is due to the fact that ICU tries to normalize
converter names. For instance, 'UTF8' is also valid,
see stringi-encoding for more information.
If simplify is FALSE, a list of
character vectors is returned. Each list element represents a unique
character encoding. The name attribute gives the ICU Canonical
Name of an encoding family. The elements (character vectors) are
its aliases.
If simplify is TRUE (the default), then the resulting list
is coerced to a character vector and sorted, and returned with
removed duplicated entries.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_management:
about_encoding,
stri_enc_info(),
stri_enc_mark(),
stri_enc_set()
stri_enc_list() stri_enc_list(FALSE)stri_enc_list() stri_enc_list(FALSE)
Reads declared encodings for each string in a character vector as seen by stringi.
stri_enc_mark(str)stri_enc_mark(str)
str |
character vector or an object coercible to a character vector |
According to Encoding,
R has a simple encoding marking mechanism:
strings can be declared to be in latin1,
UTF-8 or bytes.
Moreover, we may check (via the R/C API) whether
a string is in ASCII (R assumes that this holds if and only if
all bytes in a string are not greater than 127,
so there is an implicit assumption that your platform uses
an encoding that extends ASCII)
or in the system's default (a.k.a. unknown in Encoding)
encoding.
Intuitively, the default encoding should be equivalent to
the one you use on stdin (e.g., your 'keyboard').
In stringi we assume that such an encoding
is equivalent to the one returned by stri_enc_get.
It is automatically detected by ICU
to match – by default – the encoding part of the LC_CTYPE category
as given by Sys.getlocale.
Returns a character vector of the same length as str.
Unlike in the Encoding function, here the possible encodings are:
ASCII, latin1, bytes, native,
and UTF-8. Additionally, missing values are handled properly.
This gives exactly the same data that is used by all the functions in stringi to re-encode their inputs.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_management:
about_encoding,
stri_enc_info(),
stri_enc_list(),
stri_enc_set()
stri_enc_set sets the encoding used to re-encode strings
internally (i.e., by R) declared to be in native encoding,
see stringi-encoding and stri_enc_mark.
stri_enc_get returns the currently used default encoding.
stri_enc_set(enc) stri_enc_get()stri_enc_set(enc) stri_enc_get()
enc |
single string; character encoding name,
see |
stri_enc_get is the same as
stri_enc_info(NULL)$Name.friendly.
Note that changing the default encoding may have undesired consequences.
Unless you are an expert user and you know what you are doing,
stri_enc_set should only be used if ICU fails to detect
your system's encoding correctly (while testing stringi
we only encountered such a situation on a very old Solaris machine).
Note that ICU tries to match the encoding part of the LC_CTYPE
category as given by Sys.getlocale.
If you set a default encoding that is neither a superset of ASCII, nor an 8-bit encoding, a warning will be generated, see stringi-encoding for discussion.
stri_enc_set has no effect if the system ICU assumes that
the default charset is always UTF-8 (i.e., where the internal
U_CHARSET_IS_UTF8 is defined and set to 1), see
stri_info.
stri_enc_set returns a string with
previously used character encoding, invisibly.
stri_enc_get returns a string with current default character
encoding.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_management:
about_encoding,
stri_enc_info(),
stri_enc_list(),
stri_enc_mark()
This function converts input strings to ASCII, i.e., to character strings consisting of bytes not greater than 127.
stri_enc_toascii(str)stri_enc_toascii(str)
str |
a character vector to be converted |
All code points greater than 127 are replaced with the ASCII SUBSTITUTE
CHARACTER (0x1A).
R encoding declarations are always used to determine
which encoding is assumed for each input, see stri_enc_mark.
If ill-formed byte sequences are found in UTF-8 byte
streams, a warning is generated.
A bytes-marked string is assumed to be in an 8-bit encoding
extending the ASCII map (a common assumption in R itself).
Note that the SUBSTITUTE CHARACTER (\x1a == \032) may be interpreted
as the ASCII missing value for single characters.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_fromutf32(),
stri_enc_tonative(),
stri_enc_toutf32(),
stri_enc_toutf8(),
stri_encode()
Converts character strings with declared encodings to the current native encoding.
stri_enc_tonative(str)stri_enc_tonative(str)
str |
a character vector to be converted |
This function just calls stri_encode(str, NULL, NULL).
The current native encoding can be read with stri_enc_get.
Character strings declared to be in bytes encoding will fail here.
Note that if working in a UTF-8 environment,
resulting strings will be marked with UTF-8
and not native, see stri_enc_mark.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_fromutf32(),
stri_enc_toascii(),
stri_enc_toutf32(),
stri_enc_toutf8(),
stri_encode()
UTF-32 is a 32-bit encoding where each Unicode code point corresponds to exactly one integer value. This function converts a character vector to a list of integer vectors so that, e.g., individual code points may be easily accessed, changed, etc.
stri_enc_toutf32(str)stri_enc_toutf32(str)
str |
a character vector (or an object coercible to) to be converted |
See stri_enc_fromutf32 for a dual operation.
This function is roughly equivalent to a vectorized call
to utf8ToInt(enc2utf8(str)).
If you want a list of raw vectors on output,
use stri_encode.
Unlike utf8ToInt, if ill-formed UTF-8 byte sequences are detected,
a corresponding element is set to NULL and a warning is generated.
To deal with such issues, use, e.g., stri_enc_toutf8.
Returns a list of integer vectors.
Missing values are converted to NULLs.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_fromutf32(),
stri_enc_toascii(),
stri_enc_tonative(),
stri_enc_toutf8(),
stri_encode()
Converts character strings with declared marked encodings to UTF-8 strings.
stri_enc_toutf8(str, is_unknown_8bit = FALSE, validate = FALSE)stri_enc_toutf8(str, is_unknown_8bit = FALSE, validate = FALSE)
str |
a character vector to be converted |
is_unknown_8bit |
a single logical value, see Details |
validate |
a single logical value (can be |
If is_unknown_8bit is set to FALSE (the default),
then R encoding marks are used, see stri_enc_mark.
Bytes-marked strings will cause the function to fail.
If a string is in UTF-8 and has a byte order mark (BOM), then the BOM will be silently removed from the output string.
If the default encoding is UTF-8, see stri_enc_get,
then strings marked with native are – for efficiency reasons –
returned as-is, i.e., with unchanged markings.
A similar behavior is observed when calling enc2utf8.
For is_unknown_8bit=TRUE, if a string is declared to be neither
in ASCII nor in UTF-8, then all byte codes > 127 are replaced with
the Unicode REPLACEMENT CHARACTER (\Ufffd).
Note that the REPLACEMENT CHARACTER may be interpreted as Unicode
missing value for single characters.
Here a bytes-marked string is assumed to use an 8-bit encoding
that extends the ASCII map.
What is more, setting validate to TRUE
or NA in both cases validates the resulting UTF-8 byte stream.
If validate=TRUE, then
in case of any incorrect byte sequences, they will be
replaced with the REPLACEMENT CHARACTER.
This option may be used in a case
where you want to fix an invalid UTF-8 byte sequence.
For NA, a bogus string will be replaced with a missing value.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_fromutf32(),
stri_enc_toascii(),
stri_enc_tonative(),
stri_enc_toutf32(),
stri_encode()
These functions convert strings between encodings.
They aim to serve as a more portable and faster replacement
for R's own iconv.
stri_encode(str, from = NULL, to = NULL, to_raw = FALSE) stri_conv(str, from = NULL, to = NULL, to_raw = FALSE)stri_encode(str, from = NULL, to = NULL, to_raw = FALSE) stri_conv(str, from = NULL, to = NULL, to_raw = FALSE)
str |
a character vector, a raw vector, or
a list of |
from |
input encoding:
|
to |
target encoding:
|
to_raw |
a single logical value; indicates whether a list of raw vectors rather than a character vector should be returned |
stri_conv is an alias for stri_encode.
Refer to stri_enc_list for the list
of supported encodings and stringi-encoding
for a general discussion.
If from is either missing, '', or NULL,
and if str is a character vector
then the marked encodings are used
(see stri_enc_mark) – in such a case bytes-declared
strings are disallowed.
Otherwise, i.e., if str is a raw-type vector
or a list of raw vectors,
we assume that the input encoding is the current default encoding
as given by stri_enc_get.
However, if from is given explicitly,
the internal encoding declarations are always ignored.
For to_raw=FALSE, the output
strings always have the encodings marked according to the target converter
used (as specified by to) and the current default Encoding
(ASCII, latin1, UTF-8, native,
or bytes in all other cases).
Note that some issues might occur if to indicates, e.g.,
UTF-16 or UTF-32, as the output strings may have embedded NULs.
In such cases, please use to_raw=TRUE and consider
specifying a byte order marker (BOM) for portability reasons
(e.g., set UTF-16 or UTF-32 which automatically
adds the BOMs).
Note that stri_encode(as.raw(data), 'encodingname')
is a clever substitute for rawToChar.
In the current version of stringi, if an incorrect code point is found
on input, it is replaced with the default (for that target encoding)
'missing/erroneous' character (with a warning), e.g.,
the SUBSTITUTE character (U+001A) or the REPLACEMENT one (U+FFFD).
Occurrences thereof can be located in the output string to diagnose
the problematic sequences, e.g., by calling:
stri_locate_all_regex(converted_string, '[\ufffd\u001a]'.
Because of the way this function is currently implemented, maximal size of a single string to be converted cannot exceed ~0.67 GB.
If to_raw is FALSE,
then a character vector with encoded strings (and appropriate
encoding marks) is returned.
Otherwise, a list of vectors of type raw is produced.
Marek Gagolewski and other contributors
Conversion – ICU User Guide, https://unicode-org.github.io/icu/userguide/conversion/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other encoding_conversion:
about_encoding,
stri_enc_fromutf32(),
stri_enc_toascii(),
stri_enc_tonative(),
stri_enc_toutf32(),
stri_enc_toutf8()
Generates an ASCII string where all non-printable characters and non-ASCII characters are converted to escape sequences.
stri_escape_unicode(str)stri_escape_unicode(str)
str |
character vector |
For non-printable and certain special (well-known,
see also the R man page Quotes)
ASCII characters, the following
(also recognized in R) convention is used.
We get \a, \b, \t, \n, \v,
\f, \r, \", \', \\
or either \uXXXX (4 hex digits) or \UXXXXXXXX (8 hex digits)
otherwise.
As usual in stringi, any input string is converted to Unicode before executing the escape process.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other escape:
stri_unescape_unicode()
stri_escape_unicode('a\u0105!')stri_escape_unicode('a\u0105!')
These functions extract all substrings matching a given pattern.
stri_extract_all_* extracts all the matches.
stri_extract_first_* and stri_extract_last_*
yield the first or the last matches, respectively.
stri_extract_all(str, ..., regex, fixed, coll, charclass) stri_extract_first(str, ..., regex, fixed, coll, charclass) stri_extract_last(str, ..., regex, fixed, coll, charclass) stri_extract( str, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_extract_all_charclass( str, pattern, merge = TRUE, simplify = FALSE, omit_no_match = FALSE ) stri_extract_first_charclass(str, pattern) stri_extract_last_charclass(str, pattern) stri_extract_all_coll( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_collator = NULL ) stri_extract_first_coll(str, pattern, ..., opts_collator = NULL) stri_extract_last_coll(str, pattern, ..., opts_collator = NULL) stri_extract_all_regex( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_regex = NULL ) stri_extract_first_regex(str, pattern, ..., opts_regex = NULL) stri_extract_last_regex(str, pattern, ..., opts_regex = NULL) stri_extract_all_fixed( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_fixed = NULL ) stri_extract_first_fixed(str, pattern, ..., opts_fixed = NULL) stri_extract_last_fixed(str, pattern, ..., opts_fixed = NULL)stri_extract_all(str, ..., regex, fixed, coll, charclass) stri_extract_first(str, ..., regex, fixed, coll, charclass) stri_extract_last(str, ..., regex, fixed, coll, charclass) stri_extract( str, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_extract_all_charclass( str, pattern, merge = TRUE, simplify = FALSE, omit_no_match = FALSE ) stri_extract_first_charclass(str, pattern) stri_extract_last_charclass(str, pattern) stri_extract_all_coll( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_collator = NULL ) stri_extract_first_coll(str, pattern, ..., opts_collator = NULL) stri_extract_last_coll(str, pattern, ..., opts_collator = NULL) stri_extract_all_regex( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_regex = NULL ) stri_extract_first_regex(str, pattern, ..., opts_regex = NULL) stri_extract_last_regex(str, pattern, ..., opts_regex = NULL) stri_extract_all_fixed( str, pattern, simplify = FALSE, omit_no_match = FALSE, ..., opts_fixed = NULL ) stri_extract_first_fixed(str, pattern, ..., opts_fixed = NULL) stri_extract_last_fixed(str, pattern, ..., opts_fixed = NULL)
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
merge |
single logical value; indicates whether consecutive pattern
matches will be merged into one string;
|
simplify |
single logical value;
if |
omit_no_match |
single logical value; if |
opts_collator, opts_fixed, opts_regex
|
a named list to tune up
the search engine's settings; see |
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
Check out stri_match for the extraction of matches
to individual regex capture groups.
stri_extract, stri_extract_all, stri_extract_first,
and stri_extract_last are convenience functions.
They merely call stri_extract_*_*, depending on the arguments used.
For stri_extract_all*, if simplify=FALSE (the default), then
a list of character vectors is returned. Each list element
represents the results of a different search scenario.
If a pattern is not found and omit_no_match=FALSE,
then a character vector of length 1
with single NA value will be generated.
Otherwise, i.e., if simplify is not FALSE,
then stri_list2matrix with byrow=TRUE argument
is called on the resulting object.
In such a case, the function yields a character matrix with an appropriate
number of rows (according to the length of str, pattern, etc.).
Note that stri_list2matrix's fill argument is set
either to an empty string or NA, depending on
whether simplify is TRUE or NA, respectively.
stri_extract_first* and stri_extract_last*
return a character vector. A NA element indicates a no-match.
Note that stri_extract_last_regex searches from start to end,
but skips overlapping matches, see the example below.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_extract:
about_search,
stri_extract_all_boundaries(),
stri_match_all()
stri_extract_all('XaaaaX', regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_all('Bartolini', coll='i') stri_extract_all('stringi is so good!', charclass='\\p{Zs}') # all white-spaces stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}') stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE) stri_extract_first_charclass('AaBbCc', '\\p{Ll}') stri_extract_last_charclass('AaBbCc', '\\p{Ll}') ## Not run: # emoji support available since ICU 57 stri_extract_all_charclass(stri_enc_fromutf32(32:55200), '\\p{EMOJI}') ## End(Not run) stri_extract_all_coll(c('AaaaaaaA', 'AAAA'), 'a') stri_extract_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale='sk_SK') stri_extract_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale='sk_SK') stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_first_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_last_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_list2matrix(stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'))) stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=TRUE) stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=NA) stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE) stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE, overlap=TRUE) # Searching for the last occurrence: # Note the difference - regex searches left to right, with no overlaps. stri_extract_last_fixed("agAGA", "aga", case_insensitive=TRUE) stri_extract_last_regex("agAGA", "aga", case_insensitive=TRUE)stri_extract_all('XaaaaX', regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_all('Bartolini', coll='i') stri_extract_all('stringi is so good!', charclass='\\p{Zs}') # all white-spaces stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}') stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE) stri_extract_first_charclass('AaBbCc', '\\p{Ll}') stri_extract_last_charclass('AaBbCc', '\\p{Ll}') ## Not run: # emoji support available since ICU 57 stri_extract_all_charclass(stri_enc_fromutf32(32:55200), '\\p{EMOJI}') ## End(Not run) stri_extract_all_coll(c('AaaaaaaA', 'AAAA'), 'a') stri_extract_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale='sk_SK') stri_extract_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale='sk_SK') stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_first_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_extract_last_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) stri_list2matrix(stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'))) stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=TRUE) stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=NA) stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE) stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE, overlap=TRUE) # Searching for the last occurrence: # Note the difference - regex searches left to right, with no overlaps. stri_extract_last_fixed("agAGA", "aga", case_insensitive=TRUE) stri_extract_last_regex("agAGA", "aga", case_insensitive=TRUE)
These functions extract data between text boundaries.
stri_extract_all_boundaries( str, simplify = FALSE, omit_no_match = FALSE, ..., opts_brkiter = NULL ) stri_extract_last_boundaries(str, ..., opts_brkiter = NULL) stri_extract_first_boundaries(str, ..., opts_brkiter = NULL) stri_extract_all_words( str, simplify = FALSE, omit_no_match = FALSE, locale = NULL ) stri_extract_first_words(str, locale = NULL) stri_extract_last_words(str, locale = NULL)stri_extract_all_boundaries( str, simplify = FALSE, omit_no_match = FALSE, ..., opts_brkiter = NULL ) stri_extract_last_boundaries(str, ..., opts_brkiter = NULL) stri_extract_first_boundaries(str, ..., opts_brkiter = NULL) stri_extract_all_words( str, simplify = FALSE, omit_no_match = FALSE, locale = NULL ) stri_extract_first_words(str, locale = NULL) stri_extract_last_words(str, locale = NULL)
str |
character vector or an object coercible to |
simplify |
single logical value;
if |
omit_no_match |
single logical value; if |
... |
additional settings for |
opts_brkiter |
a named list with ICU BreakIterator's settings,
see |
locale |
|
Vectorized over str.
For more information on text boundary analysis
performed by ICU's BreakIterator, see
stringi-search-boundaries.
In case of stri_extract_*_words,
just like in stri_count_words,
ICU's word BreakIterator iterator is used
to locate the word boundaries, and all non-word characters
(UBRK_WORD_NONE rule status) are ignored.
For stri_extract_all_*,
if simplify=FALSE (the default), then a
list of character vectors is returned. Each string consists of
a separate word. In case of omit_no_match=FALSE and
if there are no words or if a string is missing,
a single NA is provided on output.
Otherwise, stri_list2matrix with byrow=TRUE argument
is called on the resulting object.
In such a case, a character matrix with length(str) rows
is returned. Note that stri_list2matrix's fill argument
is set to an empty string and NA,
for simplify TRUE and NA, respectively.
For stri_extract_first_* and stri_extract_last_*,
a character vector is returned.
A NA element indicates a no-match.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_extract:
about_search,
stri_extract_all(),
stri_match_all()
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
stri_extract_all_words('stringi: THE string processing package 123.48...')stri_extract_all_words('stringi: THE string processing package 123.48...')
Joins the elements of a character vector into one string.
stri_flatten(str, collapse = "", na_empty = FALSE, omit_empty = FALSE)stri_flatten(str, collapse = "", na_empty = FALSE, omit_empty = FALSE)
str |
a vector of strings to be coerced to character |
collapse |
a single string denoting the separator |
na_empty |
single logical value; should missing values
in |
omit_empty |
single logical value; should empty strings
in |
The stri_flatten(str, collapse='XXX') call
is equivalent to paste(str, collapse='XXX', sep='').
If you wish to use some more fancy (e.g., differing)
separators between flattened strings,
call stri_join(str, separators, collapse='').
If str is not empty, then a single string is returned.
If collapse has length > 1, then only the first string
will be used.
Returns a single string, i.e., a character vector of length 1.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other join:
%s+%(),
stri_dup(),
stri_join(),
stri_join_list()
stri_flatten(LETTERS) stri_flatten(LETTERS, collapse=',') stri_flatten(stri_dup(letters[1:6], 1:3)) stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=TRUE, omit_empty=TRUE) stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=NA)stri_flatten(LETTERS) stri_flatten(LETTERS, collapse=',') stri_flatten(stri_dup(letters[1:6], 1:3)) stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=TRUE, omit_empty=TRUE) stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=NA)
Gives the current default settings used by the ICU library.
stri_info(short = FALSE)stri_info(short = FALSE)
short |
logical; whether or not the results should be given
in a concise form; defaults to |
If short is TRUE, then a single string providing
information on the default character encoding, locale, and Unicode
as well as ICU version is returned.
Otherwise, a list with the following components is returned:
Unicode.version – version of Unicode supported
by the ICU library;
ICU.version – ICU library version used;
Locale – contains information on default locale,
as returned by stri_locale_info;
Charset.internal – fixed at c('UTF-8', 'UTF-16');
Charset.native – information on the default encoding,
as returned by stri_enc_info;
ICU.system – logical; TRUE indicates that
the system ICU libs are used, otherwise ICU was built together
with stringi;
ICU.UTF8 – logical; TRUE if the internal
U_CHARSET_IS_UTF8 flag is defined and set.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
This is the fastest way to find out whether the elements of a character vector are empty strings.
stri_isempty(str)stri_isempty(str)
str |
character vector or an object coercible to |
Missing values are handled properly.
Returns a logical vector of the same length as str.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_length(),
stri_numbytes(),
stri_pad_both(),
stri_sprintf(),
stri_width()
stri_isempty(letters[1:3]) stri_isempty(c(',', '', 'abc', '123', '\u0105\u0104')) stri_isempty(character(1))stri_isempty(letters[1:3]) stri_isempty(c(',', '', 'abc', '123', '\u0105\u0104')) stri_isempty(character(1))
These are the stringi's equivalents of the built-in
paste function.
stri_c and stri_paste are aliases for stri_join.
stri_join(..., sep = "", collapse = NULL, ignore_null = FALSE) stri_c(..., sep = "", collapse = NULL, ignore_null = FALSE) stri_paste(..., sep = "", collapse = NULL, ignore_null = FALSE)stri_join(..., sep = "", collapse = NULL, ignore_null = FALSE) stri_c(..., sep = "", collapse = NULL, ignore_null = FALSE) stri_paste(..., sep = "", collapse = NULL, ignore_null = FALSE)
... |
character vectors (or objects coercible to character vectors) whose corresponding elements are to be concatenated |
sep |
a single string; separates terms |
collapse |
a single string or |
ignore_null |
a single logical value; if |
Vectorized over each atomic vector in '...'.
Unless collapse is NULL, the result will be a single string.
Otherwise, you get a character vector of length equal
to the length of the longest argument.
If any of the arguments in '...' is a vector of length 0
(not to be confused with vectors of empty strings)
and ignore_null is FALSE, then
you will get a 0-length character vector in result.
If collapse or sep has length greater than 1,
then only the first string will be used.
In case where there are missing values in any of the input vectors,
NA is set to the corresponding element.
Note that this behavior is different from paste,
which treats missing values as ordinary strings like 'NA'.
Moreover, as usual in stringi, the resulting strings are
always in UTF-8.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other join:
%s+%(),
stri_dup(),
stri_flatten(),
stri_join_list()
stri_join(1:13, letters) stri_join(1:13, letters, sep=',') stri_join(1:13, letters, collapse='; ') stri_join(1:13, letters, sep=',', collapse='; ') stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',') stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',', collapse='; ')stri_join(1:13, letters) stri_join(1:13, letters, sep=',') stri_join(1:13, letters, collapse='; ') stri_join(1:13, letters, sep=',', collapse='; ') stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',') stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',', collapse='; ')
These functions concatenate all the strings in each character vector
in a given list.
stri_c_list and stri_paste_list are aliases for
stri_join_list.
stri_join_list(x, sep = "", collapse = NULL) stri_c_list(x, sep = "", collapse = NULL) stri_paste_list(x, sep = "", collapse = NULL)stri_join_list(x, sep = "", collapse = NULL) stri_c_list(x, sep = "", collapse = NULL) stri_paste_list(x, sep = "", collapse = NULL)
x |
a list consisting of character vectors |
sep |
a single string; separates strings in each of the character
vectors in |
collapse |
a single string or |
Unless collapse is NULL, the result will be a single string.
Otherwise, you get a character vector of length equal
to the length of x.
Vectors in x of length 0 are silently ignored.
If collapse or sep has length greater than 1,
then only the first string will be used.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other join:
%s+%(),
stri_dup(),
stri_flatten(),
stri_join()
stri_join_list( stri_extract_all_words(c('Lorem ipsum dolor sit amet.', 'Spam spam bacon sausage and spam.')), sep=', ') stri_join_list( stri_extract_all_words(c('Lorem ipsum dolor sit amet.', 'Spam spam bacon sausage and spam.')), sep=', ', collapse='. ') stri_join_list( stri_extract_all_regex( c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+' ), sep=',') stri_join_list( stri_extract_all_regex( c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+', omit_no_match=TRUE ), sep=',', collapse='; ')stri_join_list( stri_extract_all_words(c('Lorem ipsum dolor sit amet.', 'Spam spam bacon sausage and spam.')), sep=', ') stri_join_list( stri_extract_all_words(c('Lorem ipsum dolor sit amet.', 'Spam spam bacon sausage and spam.')), sep=', ', collapse='. ') stri_join_list( stri_extract_all_regex( c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+' ), sep=',') stri_join_list( stri_extract_all_regex( c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+', omit_no_match=TRUE ), sep=',', collapse='; ')
This function returns the number of code points in each string.
stri_length(str)stri_length(str)
str |
character vector or an object coercible to |
Note that the number of code points is not the same as the 'width' of the string when printed on the console.
If a given string is in UTF-8 and has not been properly normalized
(e.g., by stri_trans_nfc), the returned counts may sometimes be
misleading. See stri_count_boundaries for a method to count
Unicode characters. Moreover, if an incorrect UTF-8 byte sequence
is detected, then a warning is generated and the corresponding output element
is set to NA, see also stri_enc_toutf8 for a method
to deal with such cases.
Missing values are handled properly. For 'byte' encodings we get, as usual, an error.
Returns an integer vector of the same length as str.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_isempty(),
stri_numbytes(),
stri_pad_both(),
stri_sprintf(),
stri_width()
stri_length(LETTERS) stri_length(c('abc', '123', '\u0105\u0104')) stri_length('\u0105') # length is one, but... stri_numbytes('\u0105') # 2 bytes are used stri_numbytes(stri_trans_nfkd('\u0105')) # 3 bytes here but... stri_length(stri_trans_nfkd('\u0105')) # ...two code points (!) stri_count_boundaries(stri_trans_nfkd('\u0105'), type='character') # ...and one Unicode characterstri_length(LETTERS) stri_length(c('abc', '123', '\u0105\u0104')) stri_length('\u0105') # length is one, but... stri_numbytes('\u0105') # 2 bytes are used stri_numbytes(stri_trans_nfkd('\u0105')) # 3 bytes here but... stri_length(stri_trans_nfkd('\u0105')) # ...two code points (!) stri_count_boundaries(stri_trans_nfkd('\u0105'), type='character') # ...and one Unicode character
This function converts a given list of atomic vectors to a character matrix.
stri_list2matrix( x, byrow = FALSE, fill = NA_character_, n_min = 0, by_row = byrow )stri_list2matrix( x, byrow = FALSE, fill = NA_character_, n_min = 0, by_row = byrow )
x |
a list of atomic vectors |
byrow |
a single logical value; should the resulting matrix be transposed? |
fill |
a single string, see Details |
n_min |
a single integer value; minimal number of rows ( |
by_row |
alias of |
This function is similar to the built-in simplify2array
function. However, it always returns a character matrix,
even if each element in x is of length 1
or if elements in x are not of the same lengths.
Moreover, the elements in x are always coerced to character vectors.
If byrow is FALSE, then a matrix with length(x)
columns is returned.
The number of rows is the length of the
longest vector in x, but no less than n_min. Basically, we have
result[i,j] == x[[j]][i] if i <= length(x[[j]])
and result[i,j] == fill otherwise, see Examples.
If byrow is TRUE, then the resulting matrix is
a transposition of the above-described one.
This function may be useful, e.g., in connection with stri_split
and stri_extract_all.
Returns a character matrix.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other utils:
stri_na2empty(),
stri_remove_empty(),
stri_replace_na()
simplify2array(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f')), byrow=TRUE) simplify2array(list('a', c('b', 'c'))) stri_list2matrix(list('a', c('b', 'c'))) stri_list2matrix(list('a', c('b', 'c')), fill='') stri_list2matrix(list('a', c('b', 'c')), fill='', n_min=5)simplify2array(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f')), byrow=TRUE) simplify2array(list('a', c('b', 'c'))) stri_list2matrix(list('a', c('b', 'c'))) stri_list2matrix(list('a', c('b', 'c')), fill='') stri_list2matrix(list('a', c('b', 'c')), fill='', n_min=5)
Provides some basic information on a given locale identifier.
stri_locale_info(locale = NULL)stri_locale_info(locale = NULL)
locale |
|
With this function you may obtain some basic information on any provided locale identifier, even if it is unsupported by ICU or if you pass a malformed locale identifier (the one that is not, e.g., of the form Language_Country). See stringi-locale for discussion.
This function does not do anything really complicated. In many
cases it is similar to a call to
as.list(stri_split_fixed(locale, '_', 3L)[[1]]),
with locale case mapped.
It may be used, however, to get insight on how ICU understands a given
locale identifier.
Returns a list with the following named character strings:
Language, Country, Variant, and
Name, being their underscore separated combination.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_management:
about_locale,
stri_locale_list(),
stri_locale_set()
stri_locale_info('pl_PL') stri_locale_info('Pl_pL') # the same resultstri_locale_info('pl_PL') stri_locale_info('Pl_pL') # the same result
Creates a character vector with all available locale identifies.
stri_locale_list()stri_locale_list()
Note that some of the services may be unavailable in some locales. Querying for locale-specific services is always performed during the resource request.
See stringi-locale for more information.
Returns a character vector with locale identifiers that are known to ICU.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_management:
about_locale,
stri_locale_info(),
stri_locale_set()
stri_locale_list()stri_locale_list()
stri_locale_set changes the default locale for all the functions
in the stringi package,
i.e., establishes the meaning of the “NULL locale” argument
of locale-sensitive functions.
stri_locale_get
gives the current default locale.
stri_locale_set(locale) stri_locale_get()stri_locale_set(locale) stri_locale_get()
locale |
single string of the form |
See stringi-locale for more information on the effect of changing the default locale.
stri_locale_get is the same as stri_locale_info(NULL)$Name.
stri_locale_set returns a string with
previously used locale, invisibly.
stri_locale_get returns a string of the form Language,
Language_Country, or Language_Country_Variant,
e.g., 'en_US'.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_management:
about_locale,
stri_locale_info(),
stri_locale_list()
## Not run: oldloc <- stri_locale_set('pt_BR') # ... some locale-dependent operations # ... note that you may always modify a locale per-call # ... changing the default locale is convenient if you perform # ... many operations stri_locale_set(oldloc) # restore the previous default locale ## End(Not run)## Not run: oldloc <- stri_locale_set('pt_BR') # ... some locale-dependent operations # ... note that you may always modify a locale per-call # ... changing the default locale is convenient if you perform # ... many operations stri_locale_set(oldloc) # restore the previous default locale ## End(Not run)
These functions find the indexes (positions) where
there is a match to some pattern.
The functions stri_locate_all_* locate all the matches.
stri_locate_first_* and stri_locate_last_*
give the first and the last matches, respectively.
stri_locate_all(str, ..., regex, fixed, coll, charclass) stri_locate_first(str, ..., regex, fixed, coll, charclass) stri_locate_last(str, ..., regex, fixed, coll, charclass) stri_locate( str, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_locate_all_charclass( str, pattern, merge = TRUE, omit_no_match = FALSE, get_length = FALSE ) stri_locate_first_charclass(str, pattern, get_length = FALSE) stri_locate_last_charclass(str, pattern, get_length = FALSE) stri_locate_all_coll( str, pattern, omit_no_match = FALSE, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_first_coll( str, pattern, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_last_coll( str, pattern, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_all_regex( str, pattern, omit_no_match = FALSE, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_first_regex( str, pattern, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_last_regex( str, pattern, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_all_fixed( str, pattern, omit_no_match = FALSE, get_length = FALSE, ..., opts_fixed = NULL ) stri_locate_first_fixed( str, pattern, get_length = FALSE, ..., opts_fixed = NULL ) stri_locate_last_fixed( str, pattern, get_length = FALSE, ..., opts_fixed = NULL )stri_locate_all(str, ..., regex, fixed, coll, charclass) stri_locate_first(str, ..., regex, fixed, coll, charclass) stri_locate_last(str, ..., regex, fixed, coll, charclass) stri_locate( str, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_locate_all_charclass( str, pattern, merge = TRUE, omit_no_match = FALSE, get_length = FALSE ) stri_locate_first_charclass(str, pattern, get_length = FALSE) stri_locate_last_charclass(str, pattern, get_length = FALSE) stri_locate_all_coll( str, pattern, omit_no_match = FALSE, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_first_coll( str, pattern, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_last_coll( str, pattern, get_length = FALSE, ..., opts_collator = NULL ) stri_locate_all_regex( str, pattern, omit_no_match = FALSE, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_first_regex( str, pattern, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_last_regex( str, pattern, capture_groups = FALSE, get_length = FALSE, ..., opts_regex = NULL ) stri_locate_all_fixed( str, pattern, omit_no_match = FALSE, get_length = FALSE, ..., opts_fixed = NULL ) stri_locate_first_fixed( str, pattern, get_length = FALSE, ..., opts_fixed = NULL ) stri_locate_last_fixed( str, pattern, get_length = FALSE, ..., opts_fixed = NULL )
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
merge |
single logical value;
indicates whether consecutive sequences of indexes in the resulting
matrix should be merged; |
omit_no_match |
single logical value; if |
get_length |
single logical value; if |
opts_collator, opts_fixed, opts_regex
|
named list used to tune up
the selected search engine's settings; see
|
capture_groups |
single logical value;
whether positions of matches to parenthesized subexpressions
should be returned too (as |
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each string,
search for each pattern in one string,
and search for the i-th pattern within the i-th string.
The matches may be extracted by calling
stri_sub or stri_sub_all.
Alternatively, you may call stri_extract directly.
stri_locate, stri_locate_all, stri_locate_first,
and stri_locate_last are convenience functions.
They just call stri_locate_*_*, depending on the arguments used.
For stri_locate_all_*,
a list of integer matrices is returned. Each list element
represents the results of a separate search scenario.
The first column gives the start positions
of the matches, and the second column gives the end positions.
Moreover, two NAs in a row denote NA arguments
or a no-match (the latter only if omit_no_match is FALSE).
stri_locate_first_* and stri_locate_last_*
return an integer matrix with
two columns, giving the start and end positions of the first
or the last matches, respectively, and two NAs if and
only if they are not found.
For stri_locate_*_regex, if the match is of zero length,
end will be one character less than start.
Note that stri_locate_last_regex searches from start to end,
but skips overlapping matches, see the example below.
Setting get_length=TRUE results in the 2nd column representing
the length of the match instead of the end position. In this case,
negative length denotes a no-match.
If capture_groups=TRUE, then the outputs are equipped with the
capture_groups attribute, which is a list of matrices
giving the start-end positions of matches to parenthesized subexpressions.
Similarly to stri_match_regex, capture group names are extracted
unless looking for first/last occurrences of many different patterns.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_locate:
about_search,
stri_locate_all_boundaries()
Other indexing:
stri_locate_all_boundaries(),
stri_sub(),
stri_sub_all()
stri_locate_all('stringi', fixed='i') stri_locate_first_coll('hladn\u00FD', 'HLADNY', strength=1, locale='sk_SK') stri_locate_all_regex( c('breakfast=eggs;lunch=pizza', 'breakfast=spam', 'no food here'), '(?<when>\\w+)=(?<what>\\w+)', capture_groups=TRUE ) # named capture groups stri_locate_all_fixed("abababa", "ABA", case_insensitive=TRUE, overlap=TRUE) stri_locate_first_fixed("ababa", "aba") stri_locate_last_fixed("ababa", "aba") # starts from end stri_locate_last_regex("ababa", "aba") # no overlaps, from left to right x <- c("yes yes", "no", NA) stri_locate_all_fixed(x, "yes") stri_locate_all_fixed(x, "yes", omit_no_match=TRUE) stri_locate_all_fixed(x, "yes", get_length=TRUE) stri_locate_all_fixed(x, "yes", get_length=TRUE, omit_no_match=TRUE) stri_locate_first_fixed(x, "yes") stri_locate_first_fixed(x, "yes", get_length=TRUE) # Use regex positive-lookahead to locate overlapping pattern matches: stri_locate_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=AGA)') # note that start > end here (match of length zero)stri_locate_all('stringi', fixed='i') stri_locate_first_coll('hladn\u00FD', 'HLADNY', strength=1, locale='sk_SK') stri_locate_all_regex( c('breakfast=eggs;lunch=pizza', 'breakfast=spam', 'no food here'), '(?<when>\\w+)=(?<what>\\w+)', capture_groups=TRUE ) # named capture groups stri_locate_all_fixed("abababa", "ABA", case_insensitive=TRUE, overlap=TRUE) stri_locate_first_fixed("ababa", "aba") stri_locate_last_fixed("ababa", "aba") # starts from end stri_locate_last_regex("ababa", "aba") # no overlaps, from left to right x <- c("yes yes", "no", NA) stri_locate_all_fixed(x, "yes") stri_locate_all_fixed(x, "yes", omit_no_match=TRUE) stri_locate_all_fixed(x, "yes", get_length=TRUE) stri_locate_all_fixed(x, "yes", get_length=TRUE, omit_no_match=TRUE) stri_locate_first_fixed(x, "yes") stri_locate_first_fixed(x, "yes", get_length=TRUE) # Use regex positive-lookahead to locate overlapping pattern matches: stri_locate_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=AGA)') # note that start > end here (match of length zero)
These functions locate text boundaries
(like character, word, line, or sentence boundaries).
Use stri_locate_all_* to locate all the matches.
stri_locate_first_* and stri_locate_last_*
give the first or the last matches, respectively.
stri_locate_all_boundaries( str, omit_no_match = FALSE, get_length = FALSE, ..., opts_brkiter = NULL ) stri_locate_last_boundaries(str, get_length = FALSE, ..., opts_brkiter = NULL) stri_locate_first_boundaries(str, get_length = FALSE, ..., opts_brkiter = NULL) stri_locate_all_words( str, omit_no_match = FALSE, locale = NULL, get_length = FALSE ) stri_locate_last_words(str, locale = NULL, get_length = FALSE) stri_locate_first_words(str, locale = NULL, get_length = FALSE)stri_locate_all_boundaries( str, omit_no_match = FALSE, get_length = FALSE, ..., opts_brkiter = NULL ) stri_locate_last_boundaries(str, get_length = FALSE, ..., opts_brkiter = NULL) stri_locate_first_boundaries(str, get_length = FALSE, ..., opts_brkiter = NULL) stri_locate_all_words( str, omit_no_match = FALSE, locale = NULL, get_length = FALSE ) stri_locate_last_words(str, locale = NULL, get_length = FALSE) stri_locate_first_words(str, locale = NULL, get_length = FALSE)
str |
character vector or an object coercible to |
omit_no_match |
single logical value; if |
get_length |
single logical value; if |
... |
additional settings for |
opts_brkiter |
named list with ICU BreakIterator's settings,
see |
locale |
|
Vectorized over str.
For more information on text boundary analysis
performed by ICU's BreakIterator, see
stringi-search-boundaries.
For stri_locate_*_words,
just like in stri_extract_all_words and stri_count_words,
ICU's word BreakIterator iterator is used
to locate the word boundaries, and all non-word characters
(UBRK_WORD_NONE rule status) are ignored.
This function is equivalent to a call to
stri_locate_*_boundaries(str, type='word', skip_word_none=TRUE, locale=locale)
stri_locate_all_* yields a list of length(str)
integer matrices.
stri_locate_first_* and stri_locate_last_* generate
return an integer matrix.
See stri_locate for more details.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_locate:
about_search,
stri_locate_all()
Other indexing:
stri_locate_all(),
stri_sub(),
stri_sub_all()
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' stri_locate_all_words(test) stri_locate_all_boundaries( 'Mr. Jones and Mrs. Brown are very happy. So am I, Prof. Smith.', type='sentence', locale='en_US@ss=standard' # ICU >= 56 only )test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' stri_locate_all_words(test) stri_locate_all_boundaries( 'Mr. Jones and Mrs. Brown are very happy. So am I, Prof. Smith.', type='sentence', locale='en_US@ss=standard' # ICU >= 56 only )
These functions extract substrings in str that
match a given regex pattern. Additionally, they extract matches
to every capture group, i.e., to all the sub-patterns given
in round parentheses.
stri_match_all(str, ..., regex) stri_match_first(str, ..., regex) stri_match_last(str, ..., regex) stri_match(str, ..., regex, mode = c("first", "all", "last")) stri_match_all_regex( str, pattern, omit_no_match = FALSE, cg_missing = NA_character_, ..., opts_regex = NULL ) stri_match_first_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL ) stri_match_last_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL )stri_match_all(str, ..., regex) stri_match_first(str, ..., regex) stri_match_last(str, ..., regex) stri_match(str, ..., regex, mode = c("first", "all", "last")) stri_match_all_regex( str, pattern, omit_no_match = FALSE, cg_missing = NA_character_, ..., opts_regex = NULL ) stri_match_first_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL ) stri_match_last_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL )
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex
|
character vector; search patterns; for more details refer to stringi-search |
omit_no_match |
single logical value; if |
cg_missing |
single string to be used if a capture group match is unavailable |
opts_regex |
a named list with ICU Regex settings,
see |
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
If no pattern match is detected and omit_no_match=FALSE,
then NAs are included in the resulting matrix (matrices), see Examples.
stri_match, stri_match_all, stri_match_first,
and stri_match_last are convenience functions.
They merely call stri_match_*_regex and are
provided for consistency with other string searching functions' wrappers,
see, among others, stri_extract.
For stri_match_all*,
a list of character matrices is returned. Each list element
represents the results of a different search scenario.
For stri_match_first* and stri_match_last*
a character matrix is returned.
Each row corresponds to a different search result.
The first matrix column gives the whole match. The second one corresponds to the first capture group, the third – the second capture group, and so on.
If regular expressions feature a named capture group,
the matrix columns will be named accordingly.
However, for stri_match_first* and stri_match_last*
this will only be the case if there is a single pattern.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_extract:
about_search,
stri_extract_all(),
stri_extract_all_boundaries()
stri_match_all_regex('breakfast=eggs, lunch=pizza, dessert=icecream', '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs', 'lunch=pizza', 'no food here'), '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(?<when>\\w+)=(?<what>\\w+)') # named capture groups stri_match_first_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_last_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$') stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$', cg_missing='') # Match all the pattern of the form XYX, including overlapping matches: stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\2))')[[1]][,2] # Compare the above to: stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\1')stri_match_all_regex('breakfast=eggs, lunch=pizza, dessert=icecream', '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs', 'lunch=pizza', 'no food here'), '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_all_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(?<when>\\w+)=(?<what>\\w+)') # named capture groups stri_match_first_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_last_regex(c('breakfast=eggs;lunch=pizza', 'breakfast=bacon;lunch=spaghetti', 'no food here'), '(\\w+)=(\\w+)') stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$') stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$', cg_missing='') # Match all the pattern of the form XYX, including overlapping matches: stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\2))')[[1]][,2] # Compare the above to: stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\1')
This function replaces all missing values with empty strings.
See stri_replace_na for a generalization.
stri_na2empty(x)stri_na2empty(x)
x |
a character vector |
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other utils:
stri_list2matrix(),
stri_remove_empty(),
stri_replace_na()
stri_na2empty(c('a', NA, '', 'b'))stri_na2empty(c('a', NA, '', 'b'))
Counts the number of bytes needed to store each string in the computer's memory.
stri_numbytes(str)stri_numbytes(str)
str |
character vector or an object coercible to |
Often, this is not the function you would normally use
in your string processing activities. See stri_length instead.
For 8-bit encoded strings, this is the same as stri_length.
For UTF-8 strings, the returned values may be greater
than the number of code points, as UTF-8 is not a fixed-byte encoding:
one code point may be encoded by 1-4 bytes
(according to the current Unicode standard).
Missing values are handled properly.
The strings do not need to be re-encoded to perform this operation.
The returned values do not include the trailing NUL bytes, which are used internally to mark the end of string data (in C).
Returns an integer vector of the same length as str.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_isempty(),
stri_length(),
stri_pad_both(),
stri_sprintf(),
stri_width()
stri_numbytes(letters) stri_numbytes(c('abc', '123', '\u0105\u0104')) ## Not run: # this used to fail on Windows, where there were no native support # for 4-bytes Unicode characters; see, however, stri_unescape_unicode(): stri_numbytes('\U001F600') # compare stri_length('\U001F600') ## End(Not run)stri_numbytes(letters) stri_numbytes(c('abc', '123', '\u0105\u0104')) ## Not run: # this used to fail on Windows, where there were no native support # for 4-bytes Unicode characters; see, however, stri_unescape_unicode(): stri_numbytes('\U001F600') # compare stri_length('\U001F600') ## End(Not run)
A convenience function to tune the ICU BreakIterator's behavior
in some text boundary analysis functions, see
stringi-search-boundaries.
stri_opts_brkiter( type, locale, skip_word_none, skip_word_number, skip_word_letter, skip_word_kana, skip_word_ideo, skip_line_soft, skip_line_hard, skip_sentence_term, skip_sentence_sep )stri_opts_brkiter( type, locale, skip_word_none, skip_word_number, skip_word_letter, skip_word_kana, skip_word_ideo, skip_line_soft, skip_line_hard, skip_sentence_term, skip_sentence_sep )
type |
single string; either the break iterator type, one of |
locale |
single string, |
skip_word_none |
logical; perform no action for 'words' that do not fit into any other categories |
skip_word_number |
logical; perform no action for words that appear to be numbers |
skip_word_letter |
logical; perform no action for words that contain letters, excluding hiragana, katakana, or ideographic characters |
skip_word_kana |
logical; perform no action for words containing kana characters |
skip_word_ideo |
logical; perform no action for words containing ideographic characters |
skip_line_soft |
logical; perform no action for soft line breaks, i.e., positions where a line break is acceptable but not required |
skip_line_hard |
logical; perform no action for hard, or mandatory line breaks |
skip_sentence_term |
logical; perform no action for sentences
ending with a sentence terminator (' |
skip_sentence_sep |
logical; perform no action for sentences that do not contain an ending sentence terminator, but are ended by a hard separator or end of input |
The skip_* family of settings may be used to prevent performing
any special actions on particular types of text boundaries, e.g.,
in case of the stri_locate_all_boundaries and
stri_split_boundaries functions.
Note that custom break iterator rules (advanced users only) should be specified as a single string. For a detailed description of the syntax of RBBI rules, please refer to the ICU User Guide on Boundary Analysis.
Returns a named list object.
Omitted skip_* values act as they have been set to FALSE.
Marek Gagolewski and other contributors
ubrk.h File Reference – ICU4C API Documentation,
https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/ubrk_8h.html
Boundary Analysis – ICU User Guide, https://unicode-org.github.io/icu/userguide/boundaryanalysis/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
A convenience function to tune the ICU Collator's behavior,
e.g., in stri_compare, stri_order,
stri_unique, stri_duplicated,
as well as stri_detect_coll
and other stringi-search-coll functions.
stri_opts_collator( locale = NULL, strength = 3L, alternate_shifted = FALSE, french = FALSE, uppercase_first = NA, case_level = FALSE, normalization = FALSE, normalisation = normalization, numeric = FALSE ) stri_coll( locale = NULL, strength = 3L, alternate_shifted = FALSE, french = FALSE, uppercase_first = NA, case_level = FALSE, normalization = FALSE, normalisation = normalization, numeric = FALSE )stri_opts_collator( locale = NULL, strength = 3L, alternate_shifted = FALSE, french = FALSE, uppercase_first = NA, case_level = FALSE, normalization = FALSE, normalisation = normalization, numeric = FALSE ) stri_coll( locale = NULL, strength = 3L, alternate_shifted = FALSE, french = FALSE, uppercase_first = NA, case_level = FALSE, normalization = FALSE, normalisation = normalization, numeric = FALSE )
locale |
single string, |
strength |
single integer in {1,2,3,4}, which defines collation strength;
|
alternate_shifted |
single logical value; |
french |
single logical value; used in Canadian French;
|
uppercase_first |
single logical value; |
case_level |
single logical value; controls whether an extra case level (positioned before the third level) is generated or not |
normalization |
single logical value; if |
normalisation |
alias of |
numeric |
single logical value; when turned on, this attribute generates a collation key for the numeric value of substrings of digits; this is a way to get '100' to sort AFTER '2'; note that negative or non-integer numbers will not be ordered properly |
ICU's collator performs a locale-aware, natural-language alike string comparison. This is a more reliable way of establishing relationships between strings than the one provided by base R, and definitely one that is more complex and appropriate than ordinary bytewise comparison.
Returns a named list object; missing settings are left with default values.
Marek Gagolewski and other contributors
Collation – ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
ICU Collation Service Architecture – ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/architecture.html
icu::Collator Class Reference – ICU4C API Documentation,
https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/classicu_1_1Collator.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other search_coll:
about_search,
about_search_coll
stri_cmp('number100', 'number2') stri_cmp('number100', 'number2', opts_collator=stri_opts_collator(numeric=TRUE)) stri_cmp('number100', 'number2', numeric=TRUE) # equivalent stri_cmp('above mentioned', 'above-mentioned') stri_cmp('above mentioned', 'above-mentioned', alternate_shifted=TRUE)stri_cmp('number100', 'number2') stri_cmp('number100', 'number2', opts_collator=stri_opts_collator(numeric=TRUE)) stri_cmp('number100', 'number2', numeric=TRUE) # equivalent stri_cmp('above mentioned', 'above-mentioned') stri_cmp('above mentioned', 'above-mentioned', alternate_shifted=TRUE)
A convenience function used to tune up the behavior of stri_*_fixed
functions, see stringi-search-fixed.
stri_opts_fixed(case_insensitive = FALSE, overlap = FALSE)stri_opts_fixed(case_insensitive = FALSE, overlap = FALSE)
case_insensitive |
logical; enable simple case insensitive matching |
overlap |
logical; enable overlapping matches' detection |
Case-insensitive matching uses a simple, single-code point case mapping
(via ICU's u_toupper() function).
Full case mappings should be used whenever possible because they produce
better results by working on whole strings. They also take into account
the string context and the language, see stringi-search-coll.
Searching for overlapping pattern matches is available in
stri_extract_all_fixed, stri_locate_all_fixed,
and stri_count_fixed functions.
Returns a named list object.
Marek Gagolewski and other contributors
C/POSIX Migration – ICU User Guide, https://unicode-org.github.io/icu/userguide/icu/posix.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_fixed:
about_search,
about_search_fixed
stri_detect_fixed('ala', 'ALA') # case-sensitive by default stri_detect_fixed('ala', 'ALA', opts_fixed=stri_opts_fixed(case_insensitive=TRUE)) stri_detect_fixed('ala', 'ALA', case_insensitive=TRUE) # equivalentstri_detect_fixed('ala', 'ALA') # case-sensitive by default stri_detect_fixed('ala', 'ALA', opts_fixed=stri_opts_fixed(case_insensitive=TRUE)) stri_detect_fixed('ala', 'ALA', case_insensitive=TRUE) # equivalent
A convenience function to tune the ICU regular expressions
matcher's behavior, e.g., in stri_count_regex
and other stringi-search-regex functions.
stri_opts_regex( case_insensitive, comments, dotall, dot_all = dotall, literal, multiline, multi_line = multiline, unix_lines, uword, error_on_unknown_escapes, time_limit = 0L, stack_limit = 0L )stri_opts_regex( case_insensitive, comments, dotall, dot_all = dotall, literal, multiline, multi_line = multiline, unix_lines, uword, error_on_unknown_escapes, time_limit = 0L, stack_limit = 0L )
case_insensitive |
logical; enables case insensitive matching [regex flag |
comments |
logical; allows white space and comments within patterns [regex flag |
dotall |
logical; if set, ' |
dot_all |
alias of |
literal |
logical; if set, treat the entire pattern as a literal string: metacharacters or escape sequences in the input sequence will be given no special meaning; note that in most cases you would rather use the stringi-search-fixed facilities in this case |
multiline |
logical; controls the behavior of ' |
multi_line |
alias of |
unix_lines |
logical; Unix-only line endings;
when enabled, only |
uword |
logical; Unicode word boundaries;
if set, uses the Unicode TR 29 definition of word boundaries;
warning: Unicode word boundaries are quite different from traditional
regex word boundaries. [regex flag |
error_on_unknown_escapes |
logical; whether to generate an error on unrecognized backslash escapes; if set, fail with an error on patterns that contain backslash-escaped ASCII letters without a known special meaning; otherwise, these escaped letters represent themselves |
time_limit |
integer; processing time limit, in ~milliseconds (but not precisely so, depends on the CPU speed), for match operations; setting a limit is desirable if poorly written regexes are expected on input; 0 for no limit |
stack_limit |
integer; maximal size, in bytes, of the heap storage available for the match backtracking stack; setting a limit is desirable if poorly written regexes are expected on input; 0 for no limit |
Note that some regex settings may be changed using ICU regex flags
inside regexes. For example, '(?i)pattern' performs
a case-insensitive match of a given pattern,
see the ICU User Guide entry on Regular Expressions
in the References section or stringi-search-regex.
Returns a named list object; missing settings are left with default values.
Marek Gagolewski and other contributors
enum URegexpFlag: Constants for Regular Expression Match Modes
– ICU4C API Documentation,
https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/uregex_8h.html
Regular Expressions – ICU User Guide, https://unicode-org.github.io/icu/userguide/strings/regexp.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_regex:
about_search,
about_search_regex
stri_detect_regex('ala', 'ALA') # case-sensitive by default stri_detect_regex('ala', 'ALA', opts_regex=stri_opts_regex(case_insensitive=TRUE)) stri_detect_regex('ala', 'ALA', case_insensitive=TRUE) # equivalent stri_detect_regex('ala', '(?i)ALA') # equivalentstri_detect_regex('ala', 'ALA') # case-sensitive by default stri_detect_regex('ala', 'ALA', opts_regex=stri_opts_regex(case_insensitive=TRUE)) stri_detect_regex('ala', 'ALA', case_insensitive=TRUE) # equivalent stri_detect_regex('ala', '(?i)ALA') # equivalent
This function finds a permutation which rearranges the strings in a given character vector into the ascending or descending locale-dependent lexicographic order.
stri_order(str, decreasing = FALSE, na_last = TRUE, ..., opts_collator = NULL)stri_order(str, decreasing = FALSE, na_last = TRUE, ..., opts_collator = NULL)
str |
a character vector |
decreasing |
a single logical value; should the sort order
be nondecreasing ( |
na_last |
a single logical value; controls the treatment of |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
For more information on ICU's Collator and how to tune it up
in stringi, refer to stri_opts_collator.
As usual in stringi, non-character inputs are coerced to strings, see an example below for a somewhat non-intuitive behavior of lexicographic sorting on numeric inputs.
This function uses a stable sort algorithm (STL's stable_sort),
which performs up to element comparisons,
where is the length of str.
For ordering with regards to multiple criteria (such as sorting
data frames by more than 1 column), see stri_rank.
The function yields an integer vector that gives the sort order.
Marek Gagolewski and other contributors
Collation - ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
stri_order(c('hladny', 'chladny'), locale='pl_PL') stri_order(c('hladny', 'chladny'), locale='sk_SK') stri_order(c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_order(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers stri_order(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrectstri_order(c('hladny', 'chladny'), locale='pl_PL') stri_order(c('hladny', 'chladny'), locale='sk_SK') stri_order(c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_order(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers stri_order(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect
Add multiple pad characters at the given side(s) of each string
so that each output string is of total width of at least width.
These functions may be used to center or left/right-align each string.
stri_pad_both( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad_left( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad_right( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad( str, width = floor(0.9 * getOption("width")), side = c("left", "right", "both"), pad = " ", use_length = FALSE )stri_pad_both( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad_left( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad_right( str, width = floor(0.9 * getOption("width")), pad = " ", use_length = FALSE ) stri_pad( str, width = floor(0.9 * getOption("width")), side = c("left", "right", "both"), pad = " ", use_length = FALSE )
str |
character vector |
width |
integer vector giving minimal output string lengths |
pad |
character vector giving padding code points |
use_length |
single logical value; should the number of code
points be used instead of the total code point width
(see |
side |
[ |
Vectorized over str, width, and pad.
Each string in pad should consist of a code points of total width
equal to 1 or, if use_length is TRUE, exactly one code point.
stri_pad is a convenience function, which dispatches
to stri_pad_*.
Note that Unicode code points may have various widths when
printed on the console and that, by default, the function takes that
into account. By changing the state of the use_length
argument, this function starts acting like each code point
was of width 1. This feature should rather be used with
text in Latin script.
See stri_trim_left (among others) for reverse operation.
Also check out stri_wrap for line wrapping.
These functions return a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_isempty(),
stri_length(),
stri_numbytes(),
stri_sprintf(),
stri_width()
stri_pad_left('stringi', 10, pad='#') stri_pad_both('stringi', 8:12, pad='*') # center on screen: cat(stri_pad_both(c('the', 'string', 'processing', 'package'), getOption('width')*0.9), sep='\n') cat(stri_pad_both(c('\ud6c8\ubbfc\uc815\uc74c', # takes width into account stri_trans_nfkd('\ud6c8\ubbfc\uc815\uc74c'), 'abcd'), width=10), sep='\n')stri_pad_left('stringi', 10, pad='#') stri_pad_both('stringi', 8:12, pad='*') # center on screen: cat(stri_pad_both(c('the', 'string', 'processing', 'package'), getOption('width')*0.9), sep='\n') cat(stri_pad_both(c('\ud6c8\ubbfc\uc815\uc74c', # takes width into account stri_trans_nfkd('\ud6c8\ubbfc\uc815\uc74c'), 'abcd'), width=10), sep='\n')
Generates (pseudo)random lorem ipsum text consisting of a given number of text paragraphs.
stri_rand_lipsum(n_paragraphs, start_lipsum = TRUE, nparagraphs = n_paragraphs)stri_rand_lipsum(n_paragraphs, start_lipsum = TRUE, nparagraphs = n_paragraphs)
n_paragraphs |
single integer, number of paragraphs to generate |
start_lipsum |
single logical value; should the resulting text start with Lorem ipsum dolor sit amet? |
nparagraphs |
[DEPRECATED] alias of |
Lorem ipsum is a dummy text often used as a source of data for string processing and displaying/lay-outing exercises.
The current implementation is very simple: words are selected randomly from a Zipf distribution (based on a set of ca. 190 predefined Latin words). The number of words per sentence and sentences per paragraph follows a discretized, truncated normal distribution. No Markov chain modeling, just i.i.d. word selection.
Returns a character vector of length n_paragraphs.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other random:
stri_rand_shuffle(),
stri_rand_strings()
cat(sapply( stri_wrap(stri_rand_lipsum(10), 80, simplify=FALSE), stri_flatten, collapse='\n'), sep='\n\n') cat(stri_rand_lipsum(10), sep='\n\n')cat(sapply( stri_wrap(stri_rand_lipsum(10), 80, simplify=FALSE), stri_flatten, collapse='\n'), sep='\n\n') cat(stri_rand_lipsum(10), sep='\n\n')
Generates a (pseudo)random permutation of the code points in each string.
stri_rand_shuffle(str)stri_rand_shuffle(str)
str |
character vector |
This operation may result in non-Unicode-normalized strings and may give peculiar outputs in case of bidirectional strings.
See also stri_reverse for reversing the order of code points.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other random:
stri_rand_lipsum(),
stri_rand_strings()
stri_rand_shuffle(c('abcdefghi', '0123456789')) # you can do better than this with stri_rand_strings: stri_rand_shuffle(rep(stri_paste(letters, collapse=''), 10))stri_rand_shuffle(c('abcdefghi', '0123456789')) # you can do better than this with stri_rand_strings: stri_rand_shuffle(rep(stri_paste(letters, collapse=''), 10))
Generates (pseudo)random strings of desired lengths.
stri_rand_strings(n, length, pattern = "[A-Za-z0-9]")stri_rand_strings(n, length, pattern = "[A-Za-z0-9]")
n |
single integer, number of observations |
length |
integer vector, desired string lengths |
pattern |
character vector specifying character classes to draw elements from, see stringi-search-charclass |
Vectorized over length and pattern.
If length of length or pattern is greater than n,
then redundant elements are ignored. Otherwise,
these vectors are recycled if necessary.
This operation may result in non-Unicode-normalized strings and may give peculiar outputs for bidirectional strings.
Sampling of code points from the set specified by pattern
is always done with replacement and each code point appears with equal
probability.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other random:
stri_rand_lipsum(),
stri_rand_shuffle()
stri_rand_strings(5, 10) # 5 strings of length 10 stri_rand_strings(5, sample(1:10, 5, replace=TRUE)) # 5 strings of random lengths stri_rand_strings(10, 5, '[\\p{script=latin}&\\p{Ll}]') # small letters from the Latin script # generate n random passwords of length in [8, 14] # consisting of at least one digit, small and big ASCII letter: n <- 10 stri_rand_shuffle(stri_paste( stri_rand_strings(n, 1, '[0-9]'), stri_rand_strings(n, 1, '[a-z]'), stri_rand_strings(n, 1, '[A-Z]'), stri_rand_strings(n, sample(5:11, 5, replace=TRUE), '[a-zA-Z0-9]') ))stri_rand_strings(5, 10) # 5 strings of length 10 stri_rand_strings(5, sample(1:10, 5, replace=TRUE)) # 5 strings of random lengths stri_rand_strings(10, 5, '[\\p{script=latin}&\\p{Ll}]') # small letters from the Latin script # generate n random passwords of length in [8, 14] # consisting of at least one digit, small and big ASCII letter: n <- 10 stri_rand_shuffle(stri_paste( stri_rand_strings(n, 1, '[0-9]'), stri_rand_strings(n, 1, '[a-z]'), stri_rand_strings(n, 1, '[A-Z]'), stri_rand_strings(n, sample(5:11, 5, replace=TRUE), '[a-zA-Z0-9]') ))
This function ranks each string in a character vector according to a
locale-dependent lexicographic order.
It is a portable replacement for the base xtfrm function.
stri_rank(str, ..., opts_collator = NULL)stri_rank(str, ..., opts_collator = NULL)
str |
a character vector |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
Missing values result in missing ranks and tied observations receive the same ranks (based on min).
For more information on ICU's Collator and how to tune it up
in stringi, refer to stri_opts_collator.
The result is a vector of ranks corresponding to each
string in str.
Marek Gagolewski and other contributors
Collation – ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
stri_rank(c('hladny', 'chladny'), locale='pl_PL') stri_rank(c('hladny', 'chladny'), locale='sk_SK') stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK stri_rank("a" %s+% c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect # Ordering a data frame with respect to two criteria: X <- data.frame(a=c("b", NA, "b", "b", NA, "a", "a", "c"), b=runif(8)) X[order(stri_rank(X$a), X$b), ]stri_rank(c('hladny', 'chladny'), locale='pl_PL') stri_rank(c('hladny', 'chladny'), locale='sk_SK') stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK stri_rank("a" %s+% c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect # Ordering a data frame with respect to two criteria: X <- data.frame(a=c("b", NA, "b", "b", NA, "a", "a", "c"), b=runif(8)) X[order(stri_rank(X$a), X$b), ]
Reads a text file in ins entirety, re-encodes it, and splits it into text lines.
stri_read_lines(con, encoding = NULL, fname = con)stri_read_lines(con, encoding = NULL, fname = con)
con |
name of the output file or a connection object (opened in the binary mode) |
encoding |
single string; input encoding;
|
fname |
[DEPRECATED] alias of |
This aims to be a substitute for the readLines function,
with the ability to re-encode the input file in a much more robust way,
and split the text into lines with stri_split_lines1
(which conforms with the Unicode guidelines for newline markers).
The function calls stri_read_raw,
stri_encode, and stri_split_lines1,
in this order.
Because of the way this function is currently implemented, maximal file size cannot exceed ~0.67 GB.
Returns a character vector, each text line is a separate string. The output is always marked as UTF-8.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other files:
stri_read_raw(),
stri_write_lines()
Reads a text file as-is, with no conversion or text line splitting.
stri_read_raw(con, fname = con)stri_read_raw(con, fname = con)
con |
name of the output file or a connection object (opened in the binary mode) |
fname |
[DEPRECATED] alias of |
Once a text file is read into memory,
encoding detection (see stri_enc_detect),
conversion (see stri_encode), and/or
splitting of text into lines (see stri_split_lines1)
can be performed.
Returns a vector of type raw.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other files:
stri_read_lines(),
stri_write_lines()
stri_remove_empty (alias stri_omit_empty)
removes all empty strings from a character vector,
and, if na_empty is TRUE, also gets rid of all missing
values.
stri_remove_empty_na (alias stri_omit_empty_na)
removes both empty strings and missing values.
stri_remove_na (alias stri_omit_na)
returns a version of x with missing values removed.
stri_remove_empty(x, na_empty = FALSE) stri_omit_empty(x, na_empty = FALSE) stri_remove_empty_na(x) stri_omit_empty_na(x) stri_remove_na(x) stri_omit_na(x)stri_remove_empty(x, na_empty = FALSE) stri_omit_empty(x, na_empty = FALSE) stri_remove_empty_na(x) stri_omit_empty_na(x) stri_remove_na(x) stri_omit_na(x)
x |
a character vector |
na_empty |
should missing values be treated as empty strings? |
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other utils:
stri_list2matrix(),
stri_na2empty(),
stri_replace_na()
stri_remove_empty(stri_na2empty(c('a', NA, '', 'b'))) stri_remove_empty(c('a', NA, '', 'b')) stri_remove_empty(c('a', NA, '', 'b'), TRUE) stri_omit_empty_na(c('a', NA, '', 'b'))stri_remove_empty(stri_na2empty(c('a', NA, '', 'b'))) stri_remove_empty(c('a', NA, '', 'b')) stri_remove_empty(c('a', NA, '', 'b'), TRUE) stri_omit_empty_na(c('a', NA, '', 'b'))
These functions replace, with the given replacement string, every/first/last
substring of the input that matches the specified pattern.
stri_replace_all(str, replacement, ..., regex, fixed, coll, charclass) stri_replace_first(str, replacement, ..., regex, fixed, coll, charclass) stri_replace_last(str, replacement, ..., regex, fixed, coll, charclass) stri_replace( str, replacement, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_replace_all_charclass( str, pattern, replacement, merge = FALSE, vectorize_all = TRUE, vectorise_all = vectorize_all ) stri_replace_first_charclass(str, pattern, replacement) stri_replace_last_charclass(str, pattern, replacement) stri_replace_all_coll( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_collator = NULL ) stri_replace_first_coll(str, pattern, replacement, ..., opts_collator = NULL) stri_replace_last_coll(str, pattern, replacement, ..., opts_collator = NULL) stri_replace_all_fixed( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_fixed = NULL ) stri_replace_first_fixed(str, pattern, replacement, ..., opts_fixed = NULL) stri_replace_last_fixed(str, pattern, replacement, ..., opts_fixed = NULL) stri_replace_all_regex( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_regex = NULL ) stri_replace_first_regex(str, pattern, replacement, ..., opts_regex = NULL) stri_replace_last_regex(str, pattern, replacement, ..., opts_regex = NULL)stri_replace_all(str, replacement, ..., regex, fixed, coll, charclass) stri_replace_first(str, replacement, ..., regex, fixed, coll, charclass) stri_replace_last(str, replacement, ..., regex, fixed, coll, charclass) stri_replace( str, replacement, ..., regex, fixed, coll, charclass, mode = c("first", "all", "last") ) stri_replace_all_charclass( str, pattern, replacement, merge = FALSE, vectorize_all = TRUE, vectorise_all = vectorize_all ) stri_replace_first_charclass(str, pattern, replacement) stri_replace_last_charclass(str, pattern, replacement) stri_replace_all_coll( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_collator = NULL ) stri_replace_first_coll(str, pattern, replacement, ..., opts_collator = NULL) stri_replace_last_coll(str, pattern, replacement, ..., opts_collator = NULL) stri_replace_all_fixed( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_fixed = NULL ) stri_replace_first_fixed(str, pattern, replacement, ..., opts_fixed = NULL) stri_replace_last_fixed(str, pattern, replacement, ..., opts_fixed = NULL) stri_replace_all_regex( str, pattern, replacement, vectorize_all = TRUE, vectorise_all = vectorize_all, ..., opts_regex = NULL ) stri_replace_first_regex(str, pattern, replacement, ..., opts_regex = NULL) stri_replace_last_regex(str, pattern, replacement, ..., opts_regex = NULL)
str |
character vector; strings to search in |
replacement |
character vector with replacements for matched patterns |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
merge |
single logical value;
should consecutive matches be merged into one string;
|
vectorize_all |
single logical value;
should each occurrence of a pattern in every string
be replaced by a corresponding replacement string?;
|
vectorise_all |
alias of |
opts_collator, opts_fixed, opts_regex
|
a named list used to tune up
the search engine's settings; see
|
By default, all the functions are vectorized over
str, pattern, replacement (with recycling
of the elements in the shorter vector if necessary).
Input that is not part of any match is left unchanged;
each match is replaced in the result by the replacement string.
However, for stri_replace_all*, if vectorize_all is FALSE,
then each substring matching any of the supplied patterns
is replaced by a corresponding replacement string.
In such a case, the vectorization is over str,
and - independently - over pattern and replacement.
In other words, this is equivalent to something like
for (i in 1:npatterns) str <- stri_replace_all(str, pattern[i], replacement[i].
Note that you must set length(pattern) >= length(replacement).
In case of stri_replace_*_regex,
the replacement string may contain references to capture groups
(in round parentheses).
References are of the form $n, where n is the number
of the capture group ($1 denotes the first group).
For the literal $,
escape it with a backslash.
Moreover, ${name} are used for named capture groups.
Note that stri_replace_last_regex searches from start to end,
but skips overlapping matches, see the example below.
stri_replace, stri_replace_all, stri_replace_first,
and stri_replace_last are convenience functions; they just call
stri_replace_*_* variants, depending on the arguments used.
If you wish to remove white-spaces from the start or end
of a string, see stri_trim.
All the functions return a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_replace:
about_search,
stri_replace_rstr(),
stri_trim_both()
stri_replace_all_charclass('aaaa', '[a]', 'b', merge=c(TRUE, FALSE)) stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ') stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ', merge=TRUE) s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' stri_replace_all_fixed(s, ' ', '#') stri_replace_all_fixed(s, 'o', '0') stri_replace_all_fixed(c('1', 'NULL', '3'), 'NULL', NA) stri_replace_all_regex(s, ' .*? ', '#') stri_replace_all_regex(s, '(el|s)it', '1234') stri_replace_all_regex('abaca', 'a', c('!', '*')) stri_replace_all_regex('123|456|789', '(\\p{N}).(\\p{N})', '$2-$1') stri_replace_all_regex(c('stringi R', 'REXAMINE', '123'), '( R|R.)', ' r ') # named capture groups are available since ICU 55 ## Not run: stri_replace_all_regex('words 123 and numbers 456', '(?<numbers>[0-9]+)', '!${numbers}!') ## End(Not run) # Compare the results: stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=TRUE) stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) # Compare the results: stri_replace_all_fixed('The quicker brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) stri_replace_all_regex('The quicker brown fox jumped over the lazy dog.', '\\b'%s+%c('quick', 'brown', 'fox')%s+%'\\b', c('slow', 'black', 'bear'), vectorize_all=FALSE) # Searching for the last occurrence: # Note the difference - regex searches left to right, with no overlaps. stri_replace_last_fixed("agAGA", "aga", "*", case_insensitive=TRUE) stri_replace_last_regex("agAGA", "aga", "*", case_insensitive=TRUE)stri_replace_all_charclass('aaaa', '[a]', 'b', merge=c(TRUE, FALSE)) stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ') stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ', merge=TRUE) s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' stri_replace_all_fixed(s, ' ', '#') stri_replace_all_fixed(s, 'o', '0') stri_replace_all_fixed(c('1', 'NULL', '3'), 'NULL', NA) stri_replace_all_regex(s, ' .*? ', '#') stri_replace_all_regex(s, '(el|s)it', '1234') stri_replace_all_regex('abaca', 'a', c('!', '*')) stri_replace_all_regex('123|456|789', '(\\p{N}).(\\p{N})', '$2-$1') stri_replace_all_regex(c('stringi R', 'REXAMINE', '123'), '( R|R.)', ' r ') # named capture groups are available since ICU 55 ## Not run: stri_replace_all_regex('words 123 and numbers 456', '(?<numbers>[0-9]+)', '!${numbers}!') ## End(Not run) # Compare the results: stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=TRUE) stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) # Compare the results: stri_replace_all_fixed('The quicker brown fox jumped over the lazy dog.', c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) stri_replace_all_regex('The quicker brown fox jumped over the lazy dog.', '\\b'%s+%c('quick', 'brown', 'fox')%s+%'\\b', c('slow', 'black', 'bear'), vectorize_all=FALSE) # Searching for the last occurrence: # Note the difference - regex searches left to right, with no overlaps. stri_replace_last_fixed("agAGA", "aga", "*", case_insensitive=TRUE) stri_replace_last_regex("agAGA", "aga", "*", case_insensitive=TRUE)
This function gives a convenient way to replace each missing (NA)
value with a given string.
stri_replace_na(str, replacement = "NA")stri_replace_na(str, replacement = "NA")
str |
character vector or an object coercible to |
replacement |
single string |
This function is roughly equivalent to
str2 <- stri_enc_toutf8(str);
str2[is.na(str2)] <- stri_enc_toutf8(replacement);
str2.
It may be used, e.g., wherever the 'plain R' NA handling is
desired, see Examples.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other utils:
stri_list2matrix(),
stri_na2empty(),
stri_remove_empty()
x <- c('test', NA) stri_paste(x, 1:2) # 'test1' NA paste(x, 1:2) # 'test 1' 'NA 2' stri_paste(stri_replace_na(x), 1:2, sep=' ') # 'test 1' 'NA 2'x <- c('test', NA) stri_paste(x, 1:2) # 'test1' NA paste(x, 1:2) # 'test 1' 'NA 2' stri_paste(stri_replace_na(x), 1:2, sep=' ') # 'test 1' 'NA 2'
Converts a gsub-style replacement strings
to those which can be used in stri_replace.
In particular, $ becomes \$ and \1 becomes $1.
stri_replace_rstr(x)stri_replace_rstr(x)
x |
character vector |
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_replace:
about_search,
stri_replace_all(),
stri_trim_both()
Reverses the order of the code points in every string.
stri_reverse(str)stri_reverse(str)
str |
character vector |
Note that this operation may result in non-Unicode-normalized strings and may give peculiar outputs for bidirectional strings.
See also stri_rand_shuffle for a random permutation
of code points.
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
stri_reverse(c('123', 'abc d e f')) stri_reverse('ZXY (\u0105\u0104123$^).') stri_reverse(stri_trans_nfd('\u0105')) == stri_trans_nfd('\u0105') # A, ogonek -> agonek, Astri_reverse(c('123', 'abc d e f')) stri_reverse('ZXY (\u0105\u0104123$^).') stri_reverse(stri_trans_nfd('\u0105')) == stri_trans_nfd('\u0105') # A, ogonek -> agonek, A
This function sorts a character vector according to a locale-dependent lexicographic order.
stri_sort(str, decreasing = FALSE, na_last = NA, ..., opts_collator = NULL)stri_sort(str, decreasing = FALSE, na_last = NA, ..., opts_collator = NULL)
str |
a character vector |
decreasing |
a single logical value; should the sort order
be nondecreasing ( |
na_last |
a single logical value; controls the treatment of |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
For more information on ICU's Collator and how to tune it up
in stringi, refer to stri_opts_collator.
As usual in stringi, non-character inputs are coerced to strings, see an example below for a somewhat non-intuitive behavior of lexicographic sorting on numeric inputs.
This function uses a stable sort algorithm (STL's stable_sort),
which performs up to element comparisons,
where is the length of str.
The result is a sorted version of str,
i.e., a character vector.
Marek Gagolewski and other contributors
Collation - ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
stri_sort(c('hladny', 'chladny'), locale='pl_PL') stri_sort(c('hladny', 'chladny'), locale='sk_SK') stri_sort(sample(LETTERS)) stri_sort(c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_sort(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers stri_sort(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrectstri_sort(c('hladny', 'chladny'), locale='pl_PL') stri_sort(c('hladny', 'chladny'), locale='sk_SK') stri_sort(sample(LETTERS)) stri_sort(c(1, 100, 2, 101, 11, 10)) # lexicographic order stri_sort(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers stri_sort(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect
This function computes a locale-dependent sort key, which is an alternative
character representation of the string that, when ordered in the C locale
(which orders using the underlying bytes directly), will give an equivalent
ordering to the original string. It is useful for enhancing algorithms
that sort only in the C locale (e.g., the strcmp function in libc)
with the ability to be locale-aware.
stri_sort_key(str, ..., opts_collator = NULL)stri_sort_key(str, ..., opts_collator = NULL)
str |
a character vector |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
For more information on ICU's Collator and how to tune it up
in stringi, refer to stri_opts_collator.
See also stri_rank for ranking strings with a single character
vector, i.e., generating relative sort keys.
The result is a character vector with the same length as str that
contains the sort keys. The output is marked as bytes-encoded.
Marek Gagolewski and other contributors
Collation - ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
stri_sort_key(c('hladny', 'chladny'), locale='pl_PL') stri_sort_key(c('hladny', 'chladny'), locale='sk_SK')stri_sort_key(c('hladny', 'chladny'), locale='pl_PL') stri_sort_key(c('hladny', 'chladny'), locale='sk_SK')
These functions split each element in str into substrings.
pattern defines the delimiters that separate the inputs into tokens.
The input data between the matches become the fields themselves.
stri_split(str, ..., regex, fixed, coll, charclass) stri_split_fixed( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_fixed = NULL ) stri_split_regex( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_regex = NULL ) stri_split_coll( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_collator = NULL ) stri_split_charclass( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE )stri_split(str, ..., regex, fixed, coll, charclass) stri_split_fixed( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_fixed = NULL ) stri_split_regex( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_regex = NULL ) stri_split_coll( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE, ..., opts_collator = NULL ) stri_split_charclass( str, pattern, n = -1L, omit_empty = FALSE, tokens_only = FALSE, simplify = FALSE )
str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
pattern, regex, fixed, coll, charclass
|
character vector; search patterns; for more details refer to stringi-search |
n |
integer vector, maximal number of strings to return, and, at the same time, maximal number of text boundaries to look for |
omit_empty |
logical vector; determines whether empty
tokens should be removed from the result ( |
tokens_only |
single logical value;
may affect the result if |
simplify |
single logical value;
if |
opts_collator, opts_fixed, opts_regex
|
a named list used to tune up
the search engine's settings; see
|
Vectorized over str, pattern, n, and omit_empty
(with recycling of the elements in the shorter vector if necessary).
If n is negative, then all pieces are extracted.
Otherwise, if tokens_only is FALSE (which is the default),
then n-1 tokens are extracted (if possible) and the n-th string
gives the remainder (see Examples).
On the other hand, if tokens_only is TRUE,
then only full tokens (up to n pieces) are extracted.
omit_empty is applied during the split process: if it is set to
TRUE, then tokens of zero length are ignored. Thus, empty strings
will never appear in the resulting vector. On the other hand, if
omit_empty is NA, then empty tokens are substituted with
missing strings.
Empty search patterns are not supported. If you wish to split a
string into individual characters, use, e.g.,
stri_split_boundaries(str, type='character') for THE Unicode way.
stri_split is a convenience function. It calls either
stri_split_regex, stri_split_fixed, stri_split_coll,
or stri_split_charclass, depending on the argument used.
If simplify=FALSE (the default),
then the functions return a list of character vectors.
Otherwise, stri_list2matrix with byrow=TRUE
and n_min=n arguments is called on the resulting object.
In such a case, a character matrix with an appropriate number of rows
(according to the length of str, pattern, etc.)
is returned. Note that stri_list2matrix's fill argument
is set to an empty string and NA, for simplify equal to
TRUE and NA, respectively.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_split:
about_search,
stri_split_boundaries(),
stri_split_lines()
stri_split_fixed('a_b_c_d', '_') stri_split_fixed('a_b_c__d', '_') stri_split_fixed('a_b_c__d', '_', omit_empty=TRUE) stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=FALSE) # 'a' & remainder stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=TRUE) # 'a' & 'b' only stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=TRUE, tokens_only=TRUE) stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=FALSE, tokens_only=TRUE) stri_split_fixed('a_b_c__d', '_', omit_empty=NA) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=1, tokens_only=TRUE, omit_empty=TRUE) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=2, tokens_only=TRUE, omit_empty=TRUE) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=3, tokens_only=TRUE, omit_empty=TRUE) stri_list2matrix(stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE)) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=FALSE, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=NA) stri_split_regex(c('ab,c', 'd,ef , g', ', h', ''), '\\p{WHITE_SPACE}*,\\p{WHITE_SPACE}*', omit_empty=NA, simplify=TRUE) stri_split_charclass('Lorem ipsum dolor sit amet', '\\p{WHITE_SPACE}') stri_split_charclass(' Lorem ipsum dolor', '\\p{WHITE_SPACE}', n=3, omit_empty=c(FALSE, TRUE)) stri_split_regex('Lorem ipsum dolor sit amet', '\\p{Z}+') # see also stri_split_charclassstri_split_fixed('a_b_c_d', '_') stri_split_fixed('a_b_c__d', '_') stri_split_fixed('a_b_c__d', '_', omit_empty=TRUE) stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=FALSE) # 'a' & remainder stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=TRUE) # 'a' & 'b' only stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=TRUE, tokens_only=TRUE) stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=FALSE, tokens_only=TRUE) stri_split_fixed('a_b_c__d', '_', omit_empty=NA) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=1, tokens_only=TRUE, omit_empty=TRUE) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=2, tokens_only=TRUE, omit_empty=TRUE) stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=3, tokens_only=TRUE, omit_empty=TRUE) stri_list2matrix(stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE)) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=FALSE, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE, simplify=TRUE) stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=NA) stri_split_regex(c('ab,c', 'd,ef , g', ', h', ''), '\\p{WHITE_SPACE}*,\\p{WHITE_SPACE}*', omit_empty=NA, simplify=TRUE) stri_split_charclass('Lorem ipsum dolor sit amet', '\\p{WHITE_SPACE}') stri_split_charclass(' Lorem ipsum dolor', '\\p{WHITE_SPACE}', n=3, omit_empty=c(FALSE, TRUE)) stri_split_regex('Lorem ipsum dolor sit amet', '\\p{Z}+') # see also stri_split_charclass
This function locates text boundaries (like character, word, line, or sentence boundaries) and splits strings at the indicated positions.
stri_split_boundaries( str, n = -1L, tokens_only = FALSE, simplify = FALSE, ..., opts_brkiter = NULL )stri_split_boundaries( str, n = -1L, tokens_only = FALSE, simplify = FALSE, ..., opts_brkiter = NULL )
str |
character vector or an object coercible to |
n |
integer vector, maximal number of strings to return |
tokens_only |
single logical value; may affect the result if |
simplify |
single logical value; if |
... |
additional settings for |
opts_brkiter |
a named list with ICU BreakIterator's settings,
see |
Vectorized over str and n.
If n is negative (the default), then all text pieces are extracted.
Otherwise, if tokens_only is FALSE (which is the default),
then n-1 tokens are extracted (if possible) and the n-th string
gives the (non-split) remainder (see Examples).
On the other hand, if tokens_only is TRUE,
then only full tokens (up to n pieces) are extracted.
For more information on text boundary analysis
performed by ICU's BreakIterator, see
stringi-search-boundaries.
If simplify=FALSE (the default),
then the functions return a list of character vectors.
Otherwise, stri_list2matrix with byrow=TRUE
and n_min=n arguments is called on the resulting object.
In such a case, a character matrix with length(str) rows
is returned. Note that stri_list2matrix's fill
argument is set to an empty string and NA,
for simplify equal to TRUE and NA, respectively.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_split:
about_search,
stri_split(),
stri_split_lines()
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_trans_tolower(),
stri_unique(),
stri_wrap()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_lines(),
stri_trans_tolower(),
stri_wrap()
test <- 'The\u00a0above-mentioned features are very useful. ' %s+% 'Spam, spam, eggs, bacon, and spam. 123 456 789' stri_split_boundaries(test, type='line') stri_split_boundaries(test, type='word') stri_split_boundaries(test, type='word', skip_word_none=TRUE) stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_letter=TRUE) stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_number=TRUE) stri_split_boundaries(test, type='sentence') stri_split_boundaries(test, type='sentence', skip_sentence_sep=TRUE) stri_split_boundaries(test, type='character') # a filtered break iterator with the new ICU: stri_split_boundaries('Mr. Jones and Mrs. Brown are very happy. So am I, Prof. Smith.', type='sentence', locale='en_US@ss=standard') # ICU >= 56 onlytest <- 'The\u00a0above-mentioned features are very useful. ' %s+% 'Spam, spam, eggs, bacon, and spam. 123 456 789' stri_split_boundaries(test, type='line') stri_split_boundaries(test, type='word') stri_split_boundaries(test, type='word', skip_word_none=TRUE) stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_letter=TRUE) stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_number=TRUE) stri_split_boundaries(test, type='sentence') stri_split_boundaries(test, type='sentence', skip_sentence_sep=TRUE) stri_split_boundaries(test, type='character') # a filtered break iterator with the new ICU: stri_split_boundaries('Mr. Jones and Mrs. Brown are very happy. So am I, Prof. Smith.', type='sentence', locale='en_US@ss=standard') # ICU >= 56 only
These functions split each character string in a given vector into text lines.
stri_split_lines(str, omit_empty = FALSE) stri_split_lines1(str)stri_split_lines(str, omit_empty = FALSE) stri_split_lines1(str)
str |
character vector ( |
omit_empty |
logical vector; determines whether empty
strings should be removed from the result
[ |
Vectorized over str and omit_empty.
omit_empty is applied when splitting. If set to TRUE,
then empty strings will never appear in the resulting vector.
Newlines are represented with the Carriage Return (CR, 0x0D), Line Feed (LF, 0x0A), CRLF, or Next Line (NEL, 0x85) characters, depending on the platform. Moreover, the Unicode Standard defines two unambiguous separator characters, the Paragraph Separator (PS, 0x2029) and the Line Separator (LS, 0x2028). Sometimes also the Vertical Tab (VT, 0x0B) and the Form Feed (FF, 0x0C) are used for this purpose.
These stringi functions follow UTR#18 rules,
where a newline sequence
corresponds to the following regular expression:
(?:\u{D A}|(?!\u{D A})[\u{A}-\u{D}\u{85}\u{2028}\u{2029}].
Each match serves as a text line separator.
stri_split_lines returns a list of character vectors.
If any input string is NA, then the corresponding list element
is a single NA string.
stri_split_lines1(str) is equivalent to
stri_split_lines(str[1])[[1]] (with default parameters),
therefore it returns a character vector. Moreover, if the input string
ends with a newline sequence, the last empty string is omitted from the
file's contents into text lines.
Marek Gagolewski and other contributors
Unicode Newline Guidelines – Unicode Technical Report #13, https://www.unicode.org/standard/reports/tr13/tr13-5.html
Unicode Regular Expressions – Unicode Technical Standard #18, https://www.unicode.org/reports/tr18/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_split:
about_search,
stri_split(),
stri_split_boundaries()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_wrap()
stri_sprintf (synonym: stri_string_format)
is a Unicode-aware replacement for and enhancement of
the built-in sprintf function.
Moreover, stri_printf prints formatted strings.
stri_sprintf( format, ..., na_string = NA_character_, inf_string = "Inf", nan_string = "NaN", use_length = FALSE ) stri_string_format( format, ..., na_string = NA_character_, inf_string = "Inf", nan_string = "NaN", use_length = FALSE ) stri_printf( format, ..., file = "", sep = "\n", append = FALSE, na_string = "NA", inf_string = "Inf", nan_string = "NaN", use_length = FALSE )stri_sprintf( format, ..., na_string = NA_character_, inf_string = "Inf", nan_string = "NaN", use_length = FALSE ) stri_string_format( format, ..., na_string = NA_character_, inf_string = "Inf", nan_string = "NaN", use_length = FALSE ) stri_printf( format, ..., file = "", sep = "\n", append = FALSE, na_string = "NA", inf_string = "Inf", nan_string = "NaN", use_length = FALSE )
format |
character vector of format strings |
... |
vectors (coercible to integer, real, or character) |
na_string |
single string to represent missing values;
if |
inf_string |
single string to represent the (unsigned) infinity ( |
nan_string |
single string to represent the not-a-number ( |
use_length |
single logical value; should the number of code
points be used when applying modifiers such as |
file |
see |
sep |
see |
append |
see |
Vectorized over format and all vectors passed via ....
Unicode code points may have various widths when
printed on the console (compare stri_width).
These functions, by default (see the use_length argument), take this
into account.
These functions are not locale sensitive. For instance, numbers are
always formatted in the "POSIX" style, e.g., -123456.789
(no thousands separator, dot as a fractional separator).
Such a feature might be added at a later date, though.
All arguments passed via ... are evaluated. If some of them
are unused, a warning is generated. Too few arguments result in an error.
Note that stri_printf treats missing values in ...
as "NA" strings by default.
All format specifiers supported sprintf are
also available here. For the formatting of integers and floating-point
values, currently the system std::snprintf() is called, but
this may change in the future. Format specifiers are normalized
and necessary sanity checks are performed.
Supported conversion specifiers: dioxX (integers)
feEgGaA (floats) and s (character strings).
Supported flags: - (left-align),
+ (force output sign or blank when NaN or NA; numeric only),
<space> (output minus or space for a sign; numeric only)
0 (pad with 0s; numeric only),
# (alternative output of some numerics).
stri_printf is used for its side effect, which is printing
text on the standard output or other connection/file. Hence, it returns
invisible(NULL).
The other functions return a character vector.
Marek Gagolewski and other contributors
printf in glibc,
https://man.archlinux.org/man/printf.3
printf format strings – Wikipedia,
https://en.wikipedia.org/wiki/Printf_format_string
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_isempty(),
stri_length(),
stri_numbytes(),
stri_pad_both(),
stri_width()
stri_printf("%4s=%.3f", c("e", "e\u00b2", "\u03c0", "\u03c0\u00b2"), c(exp(1), exp(2), pi, pi^2)) x <- c( "xxabcd", "xx\u0105\u0106\u0107\u0108", stri_paste( "\u200b\u200b\u200b\u200b", "\U0001F3F4\U000E0067\U000E0062\U000E0073\U000E0063\U000E0074\U000E007F", "abcd" )) stri_printf("[%10s]", x) # minimum width = 10 stri_printf("[%-10.3s]", x) # output of max width = 3, but pad to width of 10 stri_printf("[%10s]", x, use_length=TRUE) # minimum number of Unicode code points = 10 # vectorization wrt all arguments: p <- runif(10) stri_sprintf(ifelse(p > 0.5, "P(Y=1)=%1$.2f", "P(Y=0)=%2$.2f"), p, 1-p) # using a "preformatted" logical vector: x <- c(TRUE, FALSE, FALSE, NA, TRUE, FALSE) stri_sprintf("%s) %s", letters[seq_along(x)], c("\u2718", "\u2713")[x+1]) # custom NA/Inf/NaN strings: stri_printf("%+10.3f", c(-Inf, -0, 0, Inf, NaN, NA_real_), na_string="<NA>", nan_string="\U0001F4A9", inf_string="\u221E") stri_sprintf("UNIX time %1$f is %1$s.", Sys.time()) # the following do not work in sprintf() stri_sprintf("%1$#- *2$.*3$f", 1.23456, 10, 3) # two asterisks stri_sprintf(c("%s", "%f"), pi) # re-coercion needed stri_sprintf("%1$s is %1$f UNIX time.", Sys.time()) # re-coercion needed stri_sprintf(c("%d", "%s"), factor(11:12)) # re-coercion needed stri_sprintf(c("%s", "%d"), factor(11:12)) # re-coercion neededstri_printf("%4s=%.3f", c("e", "e\u00b2", "\u03c0", "\u03c0\u00b2"), c(exp(1), exp(2), pi, pi^2)) x <- c( "xxabcd", "xx\u0105\u0106\u0107\u0108", stri_paste( "\u200b\u200b\u200b\u200b", "\U0001F3F4\U000E0067\U000E0062\U000E0073\U000E0063\U000E0074\U000E007F", "abcd" )) stri_printf("[%10s]", x) # minimum width = 10 stri_printf("[%-10.3s]", x) # output of max width = 3, but pad to width of 10 stri_printf("[%10s]", x, use_length=TRUE) # minimum number of Unicode code points = 10 # vectorization wrt all arguments: p <- runif(10) stri_sprintf(ifelse(p > 0.5, "P(Y=1)=%1$.2f", "P(Y=0)=%2$.2f"), p, 1-p) # using a "preformatted" logical vector: x <- c(TRUE, FALSE, FALSE, NA, TRUE, FALSE) stri_sprintf("%s) %s", letters[seq_along(x)], c("\u2718", "\u2713")[x+1]) # custom NA/Inf/NaN strings: stri_printf("%+10.3f", c(-Inf, -0, 0, Inf, NaN, NA_real_), na_string="<NA>", nan_string="\U0001F4A9", inf_string="\u221E") stri_sprintf("UNIX time %1$f is %1$s.", Sys.time()) # the following do not work in sprintf() stri_sprintf("%1$#- *2$.*3$f", 1.23456, 10, 3) # two asterisks stri_sprintf(c("%s", "%f"), pi) # re-coercion needed stri_sprintf("%1$s is %1$f UNIX time.", Sys.time()) # re-coercion needed stri_sprintf(c("%d", "%s"), factor(11:12)) # re-coercion needed stri_sprintf(c("%s", "%d"), factor(11:12)) # re-coercion needed
These functions check if a string starts or ends with a match to a given pattern. Also, it is possible to check if there is a match at a specific position.
stri_startswith(str, ..., fixed, coll, charclass) stri_endswith(str, ..., fixed, coll, charclass) stri_startswith_fixed( str, pattern, from = 1L, negate = FALSE, ..., opts_fixed = NULL ) stri_endswith_fixed( str, pattern, to = -1L, negate = FALSE, ..., opts_fixed = NULL ) stri_startswith_charclass(str, pattern, from = 1L, negate = FALSE) stri_endswith_charclass(str, pattern, to = -1L, negate = FALSE) stri_startswith_coll( str, pattern, from = 1L, negate = FALSE, ..., opts_collator = NULL ) stri_endswith_coll( str, pattern, to = -1L, negate = FALSE, ..., opts_collator = NULL )stri_startswith(str, ..., fixed, coll, charclass) stri_endswith(str, ..., fixed, coll, charclass) stri_startswith_fixed( str, pattern, from = 1L, negate = FALSE, ..., opts_fixed = NULL ) stri_endswith_fixed( str, pattern, to = -1L, negate = FALSE, ..., opts_fixed = NULL ) stri_startswith_charclass(str, pattern, from = 1L, negate = FALSE) stri_endswith_charclass(str, pattern, to = -1L, negate = FALSE) stri_startswith_coll( str, pattern, from = 1L, negate = FALSE, ..., opts_collator = NULL ) stri_endswith_coll( str, pattern, to = -1L, negate = FALSE, ..., opts_collator = NULL )
str |
character vector |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
pattern, fixed, coll, charclass
|
character vector defining search patterns; for more details refer to stringi-search |
from |
integer vector |
negate |
single logical value; whether a no-match to a pattern is rather of interest |
to |
integer vector |
opts_collator, opts_fixed
|
a named list used to tune up
the search engine's settings; see |
Vectorized over str, pattern,
and from or to (with recycling
of the elements in the shorter vector if necessary).
If pattern is empty, then the result is NA
and a warning is generated.
Argument start controls the start position in str
where there is a match to a pattern.
to gives the end position.
Indexes given by from or to are of course 1-based,
i.e., an index 1 denotes the first character
in a string. This gives a typical R look-and-feel.
For negative indexes in from or to, counting starts
at the end of the string. For instance, index -1 denotes the last code point
in the string.
If you wish to test for a pattern match at an arbitrary
position in str, use stri_detect.
stri_startswith and stri_endswith are convenience functions.
They call either stri_*_fixed, stri_*_coll,
or stri_*_charclass, depending on the argument used.
Relying on these underlying functions directly will make your code run
slightly faster.
Note that testing for a pattern match at the start or end of a string
has not been implemented separately for regex patterns.
For that you may use the '^' and '$' meta-characters,
see stringi-search-regex.
Each function returns a logical vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_detect:
about_search,
stri_detect()
stri_startswith_charclass(' trim me! ', '\\p{WSpace}') stri_startswith_fixed(c('a1', 'a2', 'b3', 'a4', 'c5'), 'a') stri_detect_regex(c('a1', 'a2', 'b3', 'a4', 'c5'), '^a') stri_startswith_fixed('ababa', 'ba') stri_startswith_fixed('ababa', 'ba', from=2) stri_startswith_coll(c('a1', 'A2', 'b3', 'A4', 'C5'), 'a', strength=1) pat <- stri_paste('\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ', '\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ') stri_endswith_coll('\ufdfa\ufdfa\ufdfaXYZ', pat, strength=1)stri_startswith_charclass(' trim me! ', '\\p{WSpace}') stri_startswith_fixed(c('a1', 'a2', 'b3', 'a4', 'c5'), 'a') stri_detect_regex(c('a1', 'a2', 'b3', 'a4', 'c5'), '^a') stri_startswith_fixed('ababa', 'ba') stri_startswith_fixed('ababa', 'ba', from=2) stri_startswith_coll(c('a1', 'A2', 'b3', 'A4', 'C5'), 'a', strength=1) pat <- stri_paste('\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ', '\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ') stri_endswith_coll('\ufdfa\ufdfa\ufdfaXYZ', pat, strength=1)
This function gives general statistics for a character vector,
e.g., obtained by loading a text file with the
readLines or stri_read_lines function,
where each text line' is represented by a separate string.
stri_stats_general(str)stri_stats_general(str)
str |
character vector to be aggregated |
None of the strings may contain \r or \n characters,
otherwise you will get at error.
Below by 'white space' we mean the Unicode binary property
WHITE_SPACE, see stringi-search-charclass.
Returns an integer vector with the following named elements:
Lines - number of lines (number of
non-missing strings in the vector);
LinesNEmpty - number of lines with at least
one non-WHITE_SPACE character;
Chars - total number of Unicode code points detected;
CharsNWhite - number of Unicode code points
that are not WHITE_SPACEs;
... (Other stuff that may appear in future releases of stringi).
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other stats:
stri_stats_latex()
s <- c('Lorem ipsum dolor sit amet, consectetur adipisicing elit.', 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi.', 'Cras vel lorem. Etiam pellentesque aliquet tellus.', '') stri_stats_general(s)s <- c('Lorem ipsum dolor sit amet, consectetur adipisicing elit.', 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi.', 'Cras vel lorem. Etiam pellentesque aliquet tellus.', '') stri_stats_general(s)
This function gives LaTeX-oriented statistics for a character vector,
e.g., obtained by loading a text file with the
readLines function, where each text line
is represented by a separate string.
stri_stats_latex(str)stri_stats_latex(str)
str |
character vector to be aggregated |
We use a slightly modified LaTeX Word Count algorithm implemented in Kile 2.1.3, see https://kile.sourceforge.io/team.php for the original contributors.
Returns an integer vector with the following named elements:
CharsWord - number of word characters;
CharsCmdEnvir - command and words characters;
CharsWhite - LaTeX white spaces, including { and } in some contexts;
Words - number of words;
Cmds - number of commands;
Envirs - number of environments;
... (Other stuff that may appear in future releases of stringi).
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other stats:
stri_stats_general()
s <- c('Lorem \\textbf{ipsum} dolor sit \\textit{amet}, consectetur adipisicing elit.', '\\begin{small}Proin nibh augue,\\end{small} suscipit a, scelerisque sed, lacinia in, mi.', '') stri_stats_latex(s)s <- c('Lorem \\textbf{ipsum} dolor sit \\textit{amet}, consectetur adipisicing elit.', '\\begin{small}Proin nibh augue,\\end{small} suscipit a, scelerisque sed, lacinia in, mi.', '') stri_stats_latex(s)
stri_sub extracts particular substrings at code point-based
index ranges provided. Its replacement version allows to substitute
(in-place) parts of
a string with given replacement strings. stri_sub_replace
is its forward pipe operator-friendly variant that returns
a copy of the input vector.
For extracting/replacing multiple substrings from/within each string, see
stri_sub_all.
stri_sub( str, from = 1L, to = -1L, length, use_matrix = TRUE, ignore_negative_length = FALSE ) stri_sub(str, from = 1L, to = -1L, length, omit_na = FALSE, use_matrix = TRUE) <- value stri_sub_replace(..., replacement, value = replacement)stri_sub( str, from = 1L, to = -1L, length, use_matrix = TRUE, ignore_negative_length = FALSE ) stri_sub(str, from = 1L, to = -1L, length, omit_na = FALSE, use_matrix = TRUE) <- value stri_sub_replace(..., replacement, value = replacement)
str |
character vector |
from |
integer vector giving the start indexes; alternatively,
if |
to |
integer vector giving the end indexes; mutually exclusive with
|
length |
integer vector giving the substring lengths;
mutually exclusive with |
use_matrix |
single logical value; see |
ignore_negative_length |
single logical value; whether negative lengths should be ignored or result in missing values |
omit_na |
single logical value; indicates whether missing values
in any of the indexes or in |
value |
a character vector defining the replacement strings [replacement function only] |
... |
arguments to be passed to |
replacement |
alias of |
Vectorized over str, [value], from and
(to or length). Parameters
to and length are mutually exclusive.
Indexes are 1-based, i.e., the start of a string is at index 1.
For negative indexes in from or to,
counting starts at the end of the string.
For instance, index -1 denotes the last code point in the string.
Non-positive length gives an empty string.
Argument from gives the start of a substring to extract.
Argument to defines the last index of a substring, inclusive.
Alternatively, its length may be provided.
If from is a two-column matrix, then these two columns are
used as from and to, respectively,
unless the second column is named length.
In such a case anything passed
explicitly as to or length is ignored.
Such types of index matrices are generated by stri_locate_first
and stri_locate_last. If extraction based on
stri_locate_all is needed, see
stri_sub_all.
In stri_sub, out-of-bound indexes are silently
corrected. If from > to, then an empty string is returned.
By default, negative length results in the corresponding output being
NA, see ignore_negative_length, though.
In stri_sub<-, some configurations of indexes may work as
substring 'injection' at the front, back, or in middle.
Negative length does not alter the corresponding input string.
If both to and length are provided,
length has priority over to.
Note that for some Unicode strings, the extracted substrings might not
be well-formed, especially if input strings are not normalized
(see stri_trans_nfc),
include byte order marks, Bidirectional text marks, and so on.
Handle with care.
stri_sub and stri_sub_replace return a character vector.
stri_sub<- changes the str object 'in-place'.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other indexing:
stri_locate_all(),
stri_locate_all_boundaries(),
stri_sub_all()
s <- c("spam, spam, bacon, and spam", "eggs and spam") stri_sub(s, from=-4) stri_sub(s, from=1, length=c(10, 4)) (stri_sub(s, 1, 4) <- 'stringi') x <- c('12 3456 789', 'abc', '', NA, '667') stri_sub(x, stri_locate_first_regex(x, '[0-9]+')) # see stri_extract_first stri_sub(x, stri_locate_last_regex(x, '[0-9]+')) # see stri_extract_last stri_sub_replace(x, stri_locate_first_regex(x, '[0-9]+'), omit_na=TRUE, replacement='***') # see stri_replace_first stri_sub_replace(x, stri_locate_last_regex(x, '[0-9]+'), omit_na=TRUE, replacement='***') # see stri_replace_last ## Not run: x |> stri_sub_replace(1, 5, replacement='new_substring')s <- c("spam, spam, bacon, and spam", "eggs and spam") stri_sub(s, from=-4) stri_sub(s, from=1, length=c(10, 4)) (stri_sub(s, 1, 4) <- 'stringi') x <- c('12 3456 789', 'abc', '', NA, '667') stri_sub(x, stri_locate_first_regex(x, '[0-9]+')) # see stri_extract_first stri_sub(x, stri_locate_last_regex(x, '[0-9]+')) # see stri_extract_last stri_sub_replace(x, stri_locate_first_regex(x, '[0-9]+'), omit_na=TRUE, replacement='***') # see stri_replace_first stri_sub_replace(x, stri_locate_last_regex(x, '[0-9]+'), omit_na=TRUE, replacement='***') # see stri_replace_last ## Not run: x |> stri_sub_replace(1, 5, replacement='new_substring')
stri_sub_all extracts multiple substrings from each string.
Its replacement version substitutes (in-place) multiple substrings with the
corresponding replacement strings.
stri_sub_replace_all (alias stri_sub_all_replace)
is its forward pipe operator-friendly variant, returning
a copy of the input vector.
For extracting/replacing single substrings from/within each string, see
stri_sub.
stri_sub_all( str, from = list(1L), to = list(-1L), length, use_matrix = TRUE, ignore_negative_length = TRUE ) stri_sub_all( str, from = list(1L), to = list(-1L), length, omit_na = FALSE, use_matrix = TRUE ) <- value stri_sub_replace_all(..., replacement, value = replacement) stri_sub_all_replace(..., replacement, value = replacement)stri_sub_all( str, from = list(1L), to = list(-1L), length, use_matrix = TRUE, ignore_negative_length = TRUE ) stri_sub_all( str, from = list(1L), to = list(-1L), length, omit_na = FALSE, use_matrix = TRUE ) <- value stri_sub_replace_all(..., replacement, value = replacement) stri_sub_all_replace(..., replacement, value = replacement)
str |
character vector |
from |
list of integer vector giving the start indexes; alternatively,
if |
to |
list of integer vectors giving the end indexes |
length |
list of integer vectors giving the substring lengths |
use_matrix |
single logical value; see |
ignore_negative_length |
single logical value; whether negative lengths should be ignored or result in missing values |
omit_na |
single logical value; indicates whether missing values
in any of the indexes or in |
value |
a list of character vectors defining the replacement strings [replacement function only] |
... |
arguments to be passed to |
replacement |
alias of |
Vectorized over str, [value], from and
(to or length). Just like in stri_sub, parameters
to and length are mutually exclusive.
In one of the simplest scenarios, stri_sub_all(str, from, to),
the i-th element of the resulting list
generated like stri_sub(str[i], from[[i]], to[[i]]).
As usual, if one of the inputs is shorter than the others,
recycling rule is applied.
If any of from, to, length,
or value is not a list,
it is wrapped into a list.
If from consists of a two-column matrix, then these two columns are
used as from and to, respectively,
unless the second column is named length.
Such types of index matrices are generated by
stri_locate_all.
If extraction or replacement based on stri_locate_first
or stri_locate_last is needed, see stri_sub.
In the replacement function, the index ranges must be sorted
with respect to from and must be mutually disjoint.
Negative length does not result in any altering of the
corresponding input string. On the other hand, in stri_sub_all,
this make the corresponding chunk be ignored,
see ignore_negative_length, though.
stri_sub_all returns a list of character vectors.
Its replacement versions modify the input 'in-place'.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other indexing:
stri_locate_all(),
stri_locate_all_boundaries(),
stri_sub()
x <- c('12 3456 789', 'abc', '', NA, '667') stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+')) # see stri_extract_all stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) <- '***' print(x) stri_sub_replace_all('a b c', c(1, 3, 5), c(1, 3, 5), replacement=c('A', 'B', 'C'))x <- c('12 3456 789', 'abc', '', NA, '667') stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+')) # see stri_extract_all stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) <- '***' print(x) stri_sub_replace_all('a b c', c(1, 3, 5), c(1, 3, 5), replacement=c('A', 'B', 'C'))
These functions return or modify a sub-vector where there is a match to
a given pattern. In other words, they
are roughly equivalent (but faster and easier to use) to a call to
str[stri_detect(str, ...)] or
str[stri_detect(str, ...)] <- value.
stri_subset(str, ..., regex, fixed, coll, charclass) stri_subset(str, ..., regex, fixed, coll, charclass) <- value stri_subset_fixed( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_fixed = NULL ) stri_subset_fixed(str, pattern, negate=FALSE, ..., opts_fixed=NULL) <- value stri_subset_charclass(str, pattern, omit_na = FALSE, negate = FALSE) stri_subset_charclass(str, pattern, negate=FALSE) <- value stri_subset_coll( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_collator = NULL ) stri_subset_coll(str, pattern, negate=FALSE, ..., opts_collator=NULL) <- value stri_subset_regex( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_regex = NULL ) stri_subset_regex(str, pattern, negate=FALSE, ..., opts_regex=NULL) <- valuestri_subset(str, ..., regex, fixed, coll, charclass) stri_subset(str, ..., regex, fixed, coll, charclass) <- value stri_subset_fixed( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_fixed = NULL ) stri_subset_fixed(str, pattern, negate=FALSE, ..., opts_fixed=NULL) <- value stri_subset_charclass(str, pattern, omit_na = FALSE, negate = FALSE) stri_subset_charclass(str, pattern, negate=FALSE) <- value stri_subset_coll( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_collator = NULL ) stri_subset_coll(str, pattern, negate=FALSE, ..., opts_collator=NULL) <- value stri_subset_regex( str, pattern, omit_na = FALSE, negate = FALSE, ..., opts_regex = NULL ) stri_subset_regex(str, pattern, negate=FALSE, ..., opts_regex=NULL) <- value
str |
character vector; strings to search within |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
value |
non-empty character vector of replacement strings; replacement function only |
pattern, regex, fixed, coll, charclass
|
character vector;
search patterns (no more than the length of |
omit_na |
single logical value; should missing values be excluded from the result? |
negate |
single logical value; whether a no-match is rather of interest |
opts_collator, opts_fixed, opts_regex
|
a named list used to tune up
the search engine's settings; see
|
Vectorized over str as well as partially over pattern
and value,
with recycling of the elements in the shorter vector if necessary.
As the aim here is to subset str, pattern
cannot be longer than the former. Moreover, if the number of
items to replace is not a multiple of length of value,
a warning is emitted and the unused elements are ignored.
Hence, the length of the output will be the same as length of str.
stri_subset and stri_subset<- are convenience functions.
They call either stri_subset_regex,
stri_subset_fixed, stri_subset_coll,
or stri_subset_charclass,
depending on the argument used.
The stri_subset_* functions return a character vector.
As usual, the output encoding is UTF-8.
The stri_subset_*<- functions modifies str 'in-place'.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_subset:
about_search
stri_subset_regex(c('stringi R', '123', 'ID456', ''), '^[0-9]+$') x <- c('stringi R', '123', 'ID456', '') `stri_subset_regex<-`(x, '[0-9]+$', negate=TRUE, value=NA) # returns a copy stri_subset_regex(x, '[0-9]+$') <- NA # modifies `x` in-place print(x)stri_subset_regex(c('stringi R', '123', 'ID456', ''), '^[0-9]+$') x <- c('stringi R', '123', 'ID456', '') `stri_subset_regex<-`(x, '[0-9]+$', negate=TRUE, value=NA) # returns a copy stri_subset_regex(x, '[0-9]+$') <- NA # modifies `x` in-place print(x)
stri_timezone_set changes the current default time zone for all functions
in the stringi package, i.e., establishes the meaning of the
“NULL time zone” argument to date/time processing functions.
stri_timezone_get gets the current default time zone.
For more information on time zone representation in ICU
and stringi, refer to stri_timezone_list.
stri_timezone_get() stri_timezone_set(tz)stri_timezone_get() stri_timezone_set(tz)
tz |
single string; time zone identifier |
Unless the default time zone has already been set using
stri_timezone_set, the default time zone is determined
by querying the OS with methods in ICU's internal platform utilities.
stri_timezone_set returns a string with
previously used timezone, invisibly.
stri_timezone_get returns a single string
with the current default time zone.
Marek Gagolewski and other contributors
TimeZone class – ICU API Documentation, https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/classicu_1_1TimeZone.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_info(),
stri_timezone_list()
Other timezone:
stri_timezone_info(),
stri_timezone_list()
## Not run: oldtz <- stri_timezone_set('Europe/Warsaw') # ... many time zone-dependent operations stri_timezone_set(oldtz) # restore previous default time zone ## End(Not run)## Not run: oldtz <- stri_timezone_set('Europe/Warsaw') # ... many time zone-dependent operations stri_timezone_set(oldtz) # restore previous default time zone ## End(Not run)
Provides some basic information on a given time zone identifier.
stri_timezone_info(tz = NULL, locale = NULL, display_type = "long")stri_timezone_info(tz = NULL, locale = NULL, display_type = "long")
tz |
|
locale |
|
display_type |
single string;
one of |
Used to fetch basic information on any supported time zone.
For more information on time zone representation in ICU,
see stri_timezone_list.
Returns a list with the following named components:
ID (time zone identifier),
Name (localized human-readable time zone name),
Name.Daylight (localized human-readable time zone
name when DST is used, if available),
Name.Windows (Windows time zone ID, if available),
RawOffset (raw GMT offset, in hours, before taking
daylight savings into account), and
UsesDaylightTime (states whether a time zone uses
daylight savings time in the current Gregorian calendar year).
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_list()
Other timezone:
stri_timezone_get(),
stri_timezone_list()
stri_timezone_info() stri_timezone_info(locale='sk_SK') sapply(c('short', 'long', 'generic_short', 'generic_long', 'gmt_short', 'gmt_long', 'common', 'generic_location'), function(e) stri_timezone_info('Europe/London', display_type=e))stri_timezone_info() stri_timezone_info(locale='sk_SK') sapply(c('short', 'long', 'generic_short', 'generic_long', 'gmt_short', 'gmt_long', 'common', 'generic_location'), function(e) stri_timezone_info('Europe/London', display_type=e))
Returns a list of available time zone identifiers.
stri_timezone_list(region = NA_character_, offset = NA_integer_)stri_timezone_list(region = NA_character_, offset = NA_integer_)
region |
single string;
a ISO 3166 two-letter country code or UN M.49 three-digit area code;
|
offset |
single numeric value;
a given raw offset from GMT, in hours;
|
If offset and region are NA (the default), then
all time zones are returned. Otherwise,
only time zone identifiers with a given raw offset from GMT
and/or time zones corresponding to a given region are provided.
Note that the effect of daylight savings time is ignored.
A time zone represents an offset applied to the Greenwich Mean Time (GMT) to obtain local time (Universal Coordinated Time, or UTC, is similar, but not precisely identical, to GMT; in ICU the two terms are used interchangeably since ICU does not concern itself with either leap seconds or historical behavior). The offset might vary throughout the year, if daylight savings time (DST) is used, or might be the same all year long. Typically, regions closer to the equator do not use DST. If DST is in use, then specific rules define the point where the offset changes and the amount by which it changes.
If DST is observed, then three additional bits of information are needed:
The precise date and time during the year when DST begins. In the first half of the year it is in the northern hemisphere, and in the second half of the year it is in the southern hemisphere.
The precise date and time during the year when DST ends. In the first half of the year it is in the southern hemisphere, and in the second half of the year it is in the northern hemisphere.
The amount by which the GMT offset changes when DST is in effect. This is almost always one hour.
Returns a character vector.
Marek Gagolewski and other contributors
TimeZone class – ICU API Documentation, https://unicode-org.github.io/icu-docs/apidoc/dev/icu4c/classicu_1_1TimeZone.html
ICU TimeZone classes – ICU User Guide, https://unicode-org.github.io/icu/userguide/datetime/timezone/
Date/Time Services – ICU User Guide, https://unicode-org.github.io/icu/userguide/datetime/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other datetime:
stri_datetime_add(),
stri_datetime_create(),
stri_datetime_fields(),
stri_datetime_format(),
stri_datetime_fstr(),
stri_datetime_now(),
stri_datetime_symbols(),
stri_timezone_get(),
stri_timezone_info()
Other timezone:
stri_timezone_get(),
stri_timezone_info()
stri_timezone_list() stri_timezone_list(offset=1) stri_timezone_list(offset=5.5) stri_timezone_list(offset=5.75) stri_timezone_list(region='PL') stri_timezone_list(region='US', offset=-10) # Fetch information on all time zones do.call(rbind.data.frame, lapply(stri_timezone_list(), function(tz) stri_timezone_info(tz)))stri_timezone_list() stri_timezone_list(offset=1) stri_timezone_list(offset=5.5) stri_timezone_list(offset=5.75) stri_timezone_list(region='PL') stri_timezone_list(region='US', offset=-10) # Fetch information on all time zones do.call(rbind.data.frame, lapply(stri_timezone_list(), function(tz) stri_timezone_info(tz)))
Translates Unicode code points in each input string.
stri_trans_char(str, pattern, replacement)stri_trans_char(str, pattern, replacement)
str |
character vector |
pattern |
a single character string providing code points to be translated |
replacement |
a single character string giving translated code points |
Vectorized over str and with respect to each code point
in pattern and replacement.
If pattern and replacement consist of a different number
of code points, then the extra code points in the longer of the two
are ignored, with a warning.
If code points in a given pattern are not unique, the
last corresponding replacement code point is used.
Time complexity for each string in str is
O(stri_length(str)*stri_length(pattern)).
Returns a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other transform:
stri_trans_general(),
stri_trans_list(),
stri_trans_nfc(),
stri_trans_tolower()
stri_trans_char('id.123', '.', '_') stri_trans_char('babaab', 'ab', '01') stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA')stri_trans_char('id.123', '.', '_') stri_trans_char('babaab', 'ab', '01') stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA')
ICU General transforms provide different ways for processing Unicode text. They are useful in handling a variety of different tasks, including:
locale-independent upper case, lower case, title case, full/halfwidth conversions,
normalization,
hex and character name conversions,
script to script conversion/transliteration.
stri_trans_general(str, id, rules = FALSE, forward = TRUE)stri_trans_general(str, id, rules = FALSE, forward = TRUE)
str |
character vector |
id |
a single string with transform identifier,
see |
rules |
if |
forward |
transliteration direction ( |
ICU Transforms were mainly designed to transliterate characters from one script to another (for example, from Greek to Latin, or Japanese Katakana to Latin). However, these services are also capable of handling a much broader range of tasks. In particular, the Transforms include prebuilt transformations for case conversions, for normalization conversions, for the removal of given characters, and also for a variety of language and script transliterations. Transforms can be chained together to perform a series of operations and each step of the process can use a UnicodeSet to restrict the characters that are affected.
To get the list of available transforms,
call stri_trans_list.
Note that transliterators are often combined in sequence
to achieve a desired transformation.
This is analogous to the composition of mathematical functions.
For example, given a script that converts lowercase ASCII characters
from Latin script to Katakana script, it is convenient to first
(1) separate input base characters and accents, and then (2)
convert uppercase to lowercase.
To achieve this, a compound transform can be specified as follows:
NFKD; Lower; Latin-Katakana; (with the default rules=FALSE).
Custom rule-based transliteration is also supported, see the ICU manual and below for some examples.
Transliteration is not dependent on the current locale.
Returns a character vector.
Marek Gagolewski and other contributors
General Transforms – ICU User Guide, https://unicode-org.github.io/icu/userguide/transforms/general/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other transform:
stri_trans_char(),
stri_trans_list(),
stri_trans_nfc(),
stri_trans_tolower()
stri_trans_general('gro\u00df', 'latin-ascii') stri_trans_general('stringi', 'latin-greek') stri_trans_general('stringi', 'latin-cyrillic') stri_trans_general('stringi', 'upper') # see stri_trans_toupper stri_trans_general('\u0104', 'nfd; lower') # compound id; see stri_trans_nfd stri_trans_general('Marek G\u0105golewski', 'pl-pl_FONIPA') stri_trans_general('\u2620', 'any-name') # character name stri_trans_general('\\N{latin small letter a}', 'name-any') # decode name stri_trans_general('\u2620', 'hex/c') # to hex stri_trans_general("\u201C\u2026\u201D \u0105\u015B\u0107\u017C", "NFKD; NFC; [^\\p{L}] latin-ascii") x <- "\uC885\uB85C\uAD6C \uC0AC\uC9C1\uB3D9" stringi::stri_trans_general(x, "Hangul-Latin") # Deviate from the ICU rules of romanisation of Korean, # see https://en.wikipedia.org/wiki/Romanization_of_Korean id <- " :: NFD; \u11A8 > k; \u11AE > t; \u11B8 > p; \u1105 > r; :: Hangul-Latin; " stringi::stri_trans_general(x, id, rules=TRUE)stri_trans_general('gro\u00df', 'latin-ascii') stri_trans_general('stringi', 'latin-greek') stri_trans_general('stringi', 'latin-cyrillic') stri_trans_general('stringi', 'upper') # see stri_trans_toupper stri_trans_general('\u0104', 'nfd; lower') # compound id; see stri_trans_nfd stri_trans_general('Marek G\u0105golewski', 'pl-pl_FONIPA') stri_trans_general('\u2620', 'any-name') # character name stri_trans_general('\\N{latin small letter a}', 'name-any') # decode name stri_trans_general('\u2620', 'hex/c') # to hex stri_trans_general("\u201C\u2026\u201D \u0105\u015B\u0107\u017C", "NFKD; NFC; [^\\p{L}] latin-ascii") x <- "\uC885\uB85C\uAD6C \uC0AC\uC9C1\uB3D9" stringi::stri_trans_general(x, "Hangul-Latin") # Deviate from the ICU rules of romanisation of Korean, # see https://en.wikipedia.org/wiki/Romanization_of_Korean id <- " :: NFD; \u11A8 > k; \u11AE > t; \u11B8 > p; \u1105 > r; :: Hangul-Latin; " stringi::stri_trans_general(x, id, rules=TRUE)
Returns a list of available text transform identifiers.
Each of them may be used in stri_trans_general
tasks.
stri_trans_list()stri_trans_list()
Returns a character vector.
Marek Gagolewski and other contributors
General Transforms – ICU User Guide, https://unicode-org.github.io/icu/userguide/transforms/general/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other transform:
stri_trans_char(),
stri_trans_general(),
stri_trans_nfc(),
stri_trans_tolower()
stri_trans_list()stri_trans_list()
These functions convert strings to NFC, NFKC, NFD, NFKD, or NFKC_Casefold Unicode Normalization Form or check whether strings are normalized.
stri_trans_nfc(str) stri_trans_nfd(str) stri_trans_nfkd(str) stri_trans_nfkc(str) stri_trans_nfkc_casefold(str) stri_trans_isnfc(str) stri_trans_isnfd(str) stri_trans_isnfkd(str) stri_trans_isnfkc(str) stri_trans_isnfkc_casefold(str)stri_trans_nfc(str) stri_trans_nfd(str) stri_trans_nfkd(str) stri_trans_nfkc(str) stri_trans_nfkc_casefold(str) stri_trans_isnfc(str) stri_trans_isnfd(str) stri_trans_isnfkd(str) stri_trans_isnfkc(str) stri_trans_isnfkc_casefold(str)
str |
character vector to be encoded |
Unicode Normalization Forms are formally defined normalizations of Unicode strings which, e.g., make possible to determine whether any two strings are equivalent. Essentially, the Unicode Normalization Algorithm puts all combining marks in a specified order, and uses rules for decomposition and composition to transform each string into one of the Unicode Normalization Forms.
The following Normalization Forms (NFs) are supported:
NFC (Canonical Decomposition, followed by Canonical Composition),
NFD (Canonical Decomposition),
NFKC (Compatibility Decomposition, followed by Canonical Composition),
NFKD (Compatibility Decomposition),
NFKC_Casefold (combination of NFKC, case folding, and removing ignorable characters which was introduced with Unicode 5.2).
Note that many W3C Specifications recommend using NFC for all content, because this form avoids potential interoperability problems arising from the use of canonically equivalent, yet different, character sequences in document formats on the Web. Thus, you will rather not use these functions in typical string processing activities. Most often you may assume that a string is in NFC, see RFC5198.
As usual in stringi, if the input character vector is in the native encoding, it will be automatically converted to UTF-8.
For more general text transforms refer to stri_trans_general.
The stri_trans_nf* functions return a character vector
of the same length as input (the output is always in UTF-8).
stri_trans_isnf* return a logical vector.
Marek Gagolewski and other contributors
Unicode Normalization Forms – Unicode Standard Annex #15, https://unicode.org/reports/tr15/
Unicode Format for Network Interchange – RFC5198, https://www.rfc-editor.org/rfc/rfc5198
Character Model for the World Wide Web 1.0: Normalization – W3C Working Draft, https://www.w3.org/TR/charmod-norm/
Normalization – ICU User Guide, https://unicode-org.github.io/icu/userguide/transforms/normalization/ (technical details)
Unicode Equivalence – Wikipedia, https://en.wikipedia.org/wiki/Unicode_equivalence
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other transform:
stri_trans_char(),
stri_trans_general(),
stri_trans_list(),
stri_trans_tolower()
stri_trans_nfd('\u0105') # a with ogonek -> a, ogonek stri_trans_nfkc('\ufdfa') # 1 codepoint -> 18 codepointsstri_trans_nfd('\u0105') # a with ogonek -> a, ogonek stri_trans_nfkc('\ufdfa') # 1 codepoint -> 18 codepoints
These functions transform strings either to lower case, UPPER CASE, or Title Case or perform case folding.
stri_trans_tolower(str, locale = NULL) stri_trans_toupper(str, locale = NULL) stri_trans_casefold(str) stri_trans_totitle(str, ..., opts_brkiter = NULL)stri_trans_tolower(str, locale = NULL) stri_trans_toupper(str, locale = NULL) stri_trans_casefold(str) stri_trans_totitle(str, ..., opts_brkiter = NULL)
str |
character vector |
locale |
|
... |
additional settings for |
opts_brkiter |
a named list with ICU BreakIterator's settings,
see |
Vectorized over str.
ICU implements full Unicode string case mappings. It is worth noting that, generally, case mapping:
can change the number of code points and/or code units of a string,
is language-sensitive (results may differ depending on the locale), and
is context-sensitive (a character in the input string may map differently depending on surrounding characters).
With stri_trans_totitle, if word BreakIterator
is used (the default), then the first letter of each word will be capitalized
and the rest will be transformed to lower case.
With the break iterator of type sentence, the first letter
of each sentence will be capitalized only.
Note that according the ICU User Guide,
the string 'one. two. three.' consists of one sentence.
Case folding, on the other hand, is locale-independent. Its purpose is to make two pieces of text that differ only in case identical. This may come in handy when comparing strings.
For more general (but not locale dependent)
text transforms refer to stri_trans_general.
Each function returns a character vector.
Marek Gagolewski and other contributors
Case Mappings – ICU User Guide, https://unicode-org.github.io/icu/userguide/transforms/casemappings.html
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_unique(),
stri_wrap()
Other transform:
stri_trans_char(),
stri_trans_general(),
stri_trans_list(),
stri_trans_nfc()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_wrap()
stri_trans_toupper('\u00DF', 'de_DE') # small German Eszett / scharfes S stri_cmp_eq(stri_trans_toupper('i', 'en_US'), stri_trans_toupper('i', 'tr_TR')) stri_trans_toupper(c('abc', '123', '\u0105\u0104')) stri_trans_tolower(c('AbC', '123', '\u0105\u0104')) stri_trans_totitle(c('AbC', '123', '\u0105\u0104')) stri_trans_casefold(c('AbC', '123', '\u0105\u0104')) stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.') # word boundary stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.', type='sentence')stri_trans_toupper('\u00DF', 'de_DE') # small German Eszett / scharfes S stri_cmp_eq(stri_trans_toupper('i', 'en_US'), stri_trans_toupper('i', 'tr_TR')) stri_trans_toupper(c('abc', '123', '\u0105\u0104')) stri_trans_tolower(c('AbC', '123', '\u0105\u0104')) stri_trans_totitle(c('AbC', '123', '\u0105\u0104')) stri_trans_casefold(c('AbC', '123', '\u0105\u0104')) stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.') # word boundary stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.', type='sentence')
These functions may be used, e.g., to remove unnecessary
white-spaces from strings. Trimming ends at the first or
starts at the last pattern match.
stri_trim_both(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim_left(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim_right(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim( str, side = c("both", "left", "right"), pattern = "\\P{Wspace}", negate = FALSE )stri_trim_both(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim_left(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim_right(str, pattern = "\\P{Wspace}", negate = FALSE) stri_trim( str, side = c("both", "left", "right"), pattern = "\\P{Wspace}", negate = FALSE )
str |
a character vector of strings to be trimmed |
pattern |
a single pattern, specifying the class of characters
(see stringi-search-charclass) to
to be preserved (if |
negate |
either |
side |
character [ |
Vectorized over str and pattern.
stri_trim is a convenience wrapper over stri_trim_left
and stri_trim_right.
Contrary to many other string processing libraries, our trimming functions are universal. The class of characters to be retained or trimmed can be adjusted.
For replacing pattern matches with
an arbitrary replacement string, see stri_replace.
Trimming can also be used where you would normally rely on
regular expressions. For instance, you may get
'23.5' out of 'total of 23.5 bitcoins'.
For trimming white-spaces, please note the difference
between Unicode binary property '\p{Wspace}' (more universal)
and general character category '\p{Z}',
see stringi-search-charclass.
All functions return a character vector.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other search_replace:
about_search,
stri_replace_all(),
stri_replace_rstr()
Other search_charclass:
about_search,
about_search_charclass
stri_trim_left(' aaa') stri_trim_right('r-project.org/', '\\P{P}') stri_trim_both(' Total of 23.5 bitcoins. ', '\\p{N}') stri_trim_both(' Total of 23.5 bitcoins. ', '\\P{N}', negate=TRUE)stri_trim_left(' aaa') stri_trim_right('r-project.org/', '\\P{P}') stri_trim_both(' Total of 23.5 bitcoins. ', '\\p{N}') stri_trim_both(' Total of 23.5 bitcoins. ', '\\P{N}', negate=TRUE)
Un-escapes all known escape sequences.
stri_unescape_unicode(str)stri_unescape_unicode(str)
str |
character vector |
Uses ICU's facilities to un-escape Unicode character sequences.
The following escape sequences are recognized:
\a, \b, \t, \n, \v, \?,
\e, \f, \r, \", \', \\,
\uXXXX (4 hex digits),
\UXXXXXXXX (8 hex digits),
\xXX (1-2 hex digits),
\ooo (1-3 octal digits),
\cX (control-X; X is masked with 0x1F).
For \xXX and \ooo, beware of non-valid UTF-8 byte sequences.
Note that some versions of R on Windows cannot handle
characters defined with \UXXXXXXXX.
Returns a character vector.
If an escape sequence is ill-formed,
the result will be NA and a warning will be given.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other escape:
stri_escape_unicode()
stri_unescape_unicode('a\\u0105!\\u0032\\n')stri_unescape_unicode('a\\u0105!\\u0032\\n')
This function returns a character vector like str,
but with duplicate elements removed.
stri_unique(str, ..., opts_collator = NULL)stri_unique(str, ..., opts_collator = NULL)
str |
a character vector |
... |
additional settings for |
opts_collator |
a named list with ICU Collator's options,
see |
As usual in stringi, no attributes are copied.
Unlike unique, this function
tests for canonical equivalence of strings (and not
whether the strings are just bytewise equal). Such an operation
is locale-dependent. Hence, stri_unique is significantly
slower (but much better suited for natural language processing)
than its base R counterpart.
See also stri_duplicated for indicating non-unique elements.
Returns a character vector.
Marek Gagolewski and other contributors
Collation - ICU User Guide, https://unicode-org.github.io/icu/userguide/collation/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_wrap()
# normalized and non-Unicode-normalized version of the same code point: stri_unique(c('\u0105', stri_trans_nfkd('\u0105'))) unique(c('\u0105', stri_trans_nfkd('\u0105'))) stri_unique(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1)# normalized and non-Unicode-normalized version of the same code point: stri_unique(c('\u0105', stri_trans_nfkd('\u0105'))) unique(c('\u0105', stri_trans_nfkd('\u0105'))) stri_unique(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1)
Approximates the number of text columns the 'cat()' function might use to print a string using a mono-spaced font.
stri_width(str)stri_width(str)
str |
character vector or an object coercible to |
The Unicode standard does not formalize the notion of a character width. Roughly based on http://www.cl.cam.ac.uk/~mgk25/ucs/wcwidth.c, https://github.com/nodejs/node/blob/master/src/node_i18n.cc, and UAX #11 we proceed as follows. The following code points are of width 0:
code points with general category (see stringi-search-charclass)
Me, Mn, and Cf),
C0 and C1 control codes (general category Cc)
- for compatibility with the nchar function,
Hangul Jamo medial vowels and final consonants
(code points with enumerable property UCHAR_HANGUL_SYLLABLE_TYPE
equal to U_HST_VOWEL_JAMO or U_HST_TRAILING_JAMO;
note that applying the NFC normalization with stri_trans_nfc
is encouraged),
ZERO WIDTH SPACE (U+200B),
Characters with the UCHAR_EAST_ASIAN_WIDTH enumerable property
equal to U_EA_FULLWIDTH or U_EA_WIDE are
of width 2.
Most emojis and characters with general category So (other symbols) are of width 2.
SOFT HYPHEN (U+00AD) (for compatibility with nchar)
as well as any other characters have width 1.
Returns an integer vector of the same length as str.
Marek Gagolewski and other contributors
East Asian Width – Unicode Standard Annex #11, https://www.unicode.org/reports/tr11/
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other length:
%s$%(),
stri_isempty(),
stri_length(),
stri_numbytes(),
stri_pad_both(),
stri_sprintf()
stri_width(LETTERS[1:5]) stri_width(stri_trans_nfkd('\u0105')) stri_width(stri_trans_nfkd('\U0001F606')) stri_width( # Full-width equivalents of ASCII characters: stri_enc_fromutf32(as.list(c(0x3000, 0xFF01:0xFF5E))) ) stri_width(stri_trans_nfkd('\ubc1f')) # includes Hangul Jamo medial vowels and final consonantsstri_width(LETTERS[1:5]) stri_width(stri_trans_nfkd('\u0105')) stri_width(stri_trans_nfkd('\U0001F606')) stri_width( # Full-width equivalents of ASCII characters: stri_enc_fromutf32(as.list(c(0x3000, 0xFF01:0xFF5E))) ) stri_width(stri_trans_nfkd('\ubc1f')) # includes Hangul Jamo medial vowels and final consonants
This function breaks text paragraphs into lines,
of total width (if it is possible) at most given width.
stri_wrap( str, width = floor(0.9 * getOption("width")), cost_exponent = 2, simplify = TRUE, normalize = TRUE, normalise = normalize, indent = 0, exdent = 0, prefix = "", initial = prefix, whitespace_only = FALSE, use_length = FALSE, locale = NULL )stri_wrap( str, width = floor(0.9 * getOption("width")), cost_exponent = 2, simplify = TRUE, normalize = TRUE, normalise = normalize, indent = 0, exdent = 0, prefix = "", initial = prefix, whitespace_only = FALSE, use_length = FALSE, locale = NULL )
str |
character vector of strings to reformat |
width |
single integer giving the suggested maximal total width/number of code points per line |
cost_exponent |
single numeric value, values not greater than zero will select a greedy word-wrapping algorithm; otherwise this value denotes the exponent in the cost function of a (more aesthetic) dynamic programming-based algorithm (values in [2, 3] are recommended) |
simplify |
single logical value, see Value |
normalize |
single logical value, see Details |
normalise |
alias of |
indent |
single non-negative integer; gives the indentation of the first line in each paragraph |
exdent |
single non-negative integer; specifies the indentation of subsequent lines in paragraphs |
prefix, initial
|
single strings; |
whitespace_only |
single logical value; allow breaks only at white-spaces?
if |
use_length |
single logical value; should the number of code
points be used instead of the total code point width (see |
locale |
|
Vectorized over str.
If whitespace_only is FALSE,
then ICU's line-BreakIterator is used to determine
text boundaries where a line break is possible.
This is a locale-dependent operation.
Otherwise, the breaks are only at white-spaces.
Note that Unicode code points may have various widths when
printed on the console and that this function, by default, takes that
into account. By changing the state of the use_length
argument, this function starts to act as if each code point
was of width 1.
If normalize is FALSE,
then multiple white spaces between the word boundaries are
preserved within each wrapped line.
In such a case, none of the strings can contain \r, \n,
or other new line characters, otherwise you will get an error.
You should split the input text into lines
or, for example, substitute line breaks with spaces
before applying this function.
If normalize is TRUE, then
all consecutive white space (ASCII space, horizontal TAB, CR, LF)
sequences are replaced with single ASCII spaces
before actual string wrapping. Moreover, stri_split_lines
and stri_trans_nfc is called on the input character vector.
This is for compatibility with strwrap.
The greedy algorithm (for cost_exponent being non-positive)
provides a very simple way for word wrapping.
It always puts as many words in each line as possible.
This method – contrary to the dynamic algorithm – does not minimize
the number of space left at the end of every line.
The dynamic algorithm (a.k.a. Knuth's word wrapping algorithm)
is more complex, but it returns text wrapped
in a more aesthetic way. This method minimizes the squared
(by default, see cost_exponent) number of spaces (raggedness)
at the end of each line, so the text is mode arranged evenly.
Note that the cost of printing the last line is always zero.
If simplify is TRUE, then a character vector is returned.
Otherwise, you will get a list of length(str) character vectors.
Marek Gagolewski and other contributors
D.E. Knuth, M.F. Plass, Breaking paragraphs into lines, Software: Practice and Experience 11(11), 1981, pp. 1119–1184.
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other locale_sensitive:
%s<%(),
about_locale,
about_search_boundaries,
about_search_coll,
stri_compare(),
stri_count_boundaries(),
stri_duplicated(),
stri_enc_detect2(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_collator(),
stri_order(),
stri_rank(),
stri_sort(),
stri_sort_key(),
stri_split_boundaries(),
stri_trans_tolower(),
stri_unique()
Other text_boundaries:
about_search,
about_search_boundaries,
stri_count_boundaries(),
stri_extract_all_boundaries(),
stri_locate_all_boundaries(),
stri_opts_brkiter(),
stri_split_boundaries(),
stri_split_lines(),
stri_trans_tolower()
s <- stri_paste( 'Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin ', 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel ', 'lorem. Etiam pellentesque aliquet tellus.') cat(stri_wrap(s, 20, 0.0), sep='\n') # greedy cat(stri_wrap(s, 20, 2.0), sep='\n') # dynamic cat(stri_pad(stri_wrap(s), side='both'), sep='\n')s <- stri_paste( 'Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin ', 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel ', 'lorem. Etiam pellentesque aliquet tellus.') cat(stri_wrap(s, 20, 0.0), sep='\n') # greedy cat(stri_wrap(s, 20, 2.0), sep='\n') # dynamic cat(stri_pad(stri_wrap(s), side='both'), sep='\n')
Writes a text file is such a way that each element of a given character vector becomes a separate text line.
stri_write_lines( str, con, encoding = "UTF-8", sep = ifelse(.Platform$OS.type == "windows", "\r\n", "\n"), fname = con )stri_write_lines( str, con, encoding = "UTF-8", sep = ifelse(.Platform$OS.type == "windows", "\r\n", "\n"), fname = con )
str |
character vector with data to write |
con |
name of the output file or a connection object (opened in the binary mode) |
encoding |
output encoding, |
sep |
newline separator |
fname |
[DEPRECATED] alias of |
It is a substitute for the R writeLines function,
with the ability to easily re-encode the output.
We suggest using the UTF-8 encoding for all text files: thus, it is the default one for the output.
This function returns nothing noteworthy.
Marek Gagolewski and other contributors
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other files:
stri_read_lines(),
stri_read_raw()